Description :
From Genome Similarity Track
Location :
Scaffold_133:51562- 55019
Transcript NameFunction/comments
Physo_143246reverse transcriptase

Sequence
3457 bases(100 bases per row)
CTTCCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCGACACCTGAGTCTGTATAGACTGACCCTCTGTGGAGAATG
GAGCAGTTCGCTCACTTACCCCCGAACCAGCAGGATGCGCTTAAAAAGCTTATGTCCTTGCTGGGTCCGGAGGGCGTGACGCAACTTGCGCAGCAAGGCC
CCGACGCGGTGAACGCGCGTCTCGAGGCGTTTTCAAGCTACGAGAATGCTGTCCTAGAGCACCTCCAGCAGAGGATGGCGACGGCCGCGGCGCCCCAAGC
GCCCGCTTCGTCATTCGACGCGGGAACAAGACCCAAGCCGCTCATGTTGAGCGTGACGACCTTCGAAGGCAAAGAGGGTGAAAGCTTGATGCTTTGGACC
CGTGAGGTTGAGATGGCTATGAGCTCAGCTCTACTCCGGACGGAGTCGCAGTGCGTGGCACTAGCTATCTCGAAGCTCGGTGGGCGAGCGAGAGAGTGGG
CACTACGTCGGTCGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAACAGCAATTGTCTCGAGTGTTCGCTCCGCCTAACGAGGCGTATGGCGTGCGCTCA
CGCTTCCTGTCTGCTCGGCGGCGCAAGAAGGAGTTGGTGGACTATGTCCAAGAACTGAGAACTCTCATTGCAGGAATGTCTGCTGACCCGTTGCCGGAGG
CAGTCACCGTCACGGTGTTCACGGAGGGCCTCCGCACTGGCGTTGCCAGGACGGAGGTGTTCCGAACCCACCCGAGCTCTTTTGAAGAGGTTGTGAGCGT
CGCATTGAATGCGGAGCACAACTTTAAGTCGTCGAGACTTGGGTGGAATGCGTCTTACGCTAGCTCGTCGAATGGTCCGGAACCCATGGACCTCAGCTAC
GCTGAAGACGAAGAAACCGAGCTTCGTGCTGCTGAGCAGCGGCGCGGTATCCGCAGATGCTTCATCTGTGGTGACACCCGTCACCTTCGTGCTGGGTGCC
CGCTGCGCCATCAGCGCCAGGCTTCGTCAAACCGCTCCTCTAGTTCGAGCCAGGGATCTGGTTCGTCTCGGGGAAACGAGAACTCCCAGTAGGCGCGGGG
CGGCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGCCCCGAAGAGAGCCGTACTCTCTAACACGGAACGTG
TATGCAAGCCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACCAAGCCATGGACGATTTTGATCGATTCGGGAGCGTCGGGTAACTACGCCCG
GCGTTCTACGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCGGGAGTGACATCGTCACTGTTCGTCTCGCGACGGGCCTAAGGTCCCTG
TGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGAAACGCTGTCCGGTCTTAGACCTCGATTCGAGATATGATCTCATCCTTGGTATGGCGTGGCT
GGAACGCCACGAGCCTTGGATCGATTGGAGGTCGAAGACCCTTGCTGCCACGCACTTCTCTCCTTGCGGAGCATTGGCTAGTCATGAACCCACCTCTGCT
AGGAAGCAGAAGCTTTCTGGCGCGAGCACTGGACCGAGTCGGTCAATGTGCTGGACATCGGAGTTTCCGAGTTGGTGGACACTGTGTGTAGCGTTCCGAG
CGTGGCTCGCGGACGGCAGGTGGAGCGGCACGAATTCCGCTGAGCGGGTGTGCGTCTGAGGGCGACGCCCTGCTGCGTGCCAGCGACGGCGCGGTCGGTA
TGATGCCGAAGAATAAGGGGCTTTGCCCGGATGAAGATCGTGGAGTGGCACGTAATCCACTGAGTGGAGGCTGCGGATCGTGCAGCTCTTCGCTGAGTGT
CGGTAAAGACACTGGAGTTCCCCCGGAGCTGAACGAGGTGGTGACACCTGGCGTCAAGACGCACGCGAAATCACGGAGCTCTTCAGGGCGGACGGTGTCC
ATGAAGAGGAGGCAGCGCCGCAAAGCGCTGGCTGCGAGACGCAAGGCGTCTGCGATCTCACGAGTCGAGAAGGGCGTGTTGAGCGGTGAGGCTCCACGCG
AGAGCGAGCAGCTCTATACACTCGTAAATGGAGTGACGGGCGACGTCGACAGAGGTATCAACCTCGACGACTTGCCCTCACTGTCTGCTCTCCTGGAGCT
GGACGAGATGTCCTTGGCCGAGTTCGGCGAAGCCTTGAAGGCTGGAGACTTGGCTGAGGTAGTGGTCATACGACCCGAAGAAGAGTTGAATTCGTCCTCG
CTTCTGGATGAAGCTGTCCTGGAAGACACCAAGATGGCGCTGAATGCGCGGAGCCGATCGGCGATCCTGAAGGACCCGTCGGATCCCTTGTATCAAGTGG
TAAAGGATTACCAGGACGTGGTCTCGATGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGTTCGACACGAAATCGATCTCGTTTCGGGAACGAAGTA
CTGCGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAGCACGAGGCGGGCATGGTGCGTGAGAGTAAG
GCTCCACACTCTACGCCGACGTTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTTCAACAAGCTAAATGCCGCTACCATTCCGGCGC
AGACGCCGATTCCTCGGAAGGATGTCCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTTGGTCGATGGATATTACTAATTGCTCAT
GAGGACGAGCGACATTCCTCTCACTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGAGTGGTTGGTGATGCCCCAAGGGATTTCGAACACGCCAGCGACG
TTTAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAACGTACTTCGATGACATCTTTGTCCACAGTCGTGCGGAGCACGGAAAGA
CTGATATGGAGAACCATGTGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGTCAAAACAAGTTGTACACCAACATTGACAAATGCATCTTCGGAGCAGA
AGAGATCCCCTTCTTCGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGAACCAG
AAGAATCTTCGCAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGA
TGCGAAGTGGTGTTGGGACACCGAACATCAAGATGCGTTTGCGGCAATTAAGGACAGTCTCCTTCATGCGCCTATTCTGGCTTTGCCAGACCCCGCTCGT
CCGTTTAGTGTCGTCTGTGACGCCTCGGACTTTCCCATCGGCTGTGCCCTGCTGCAA