Description :
From Genome Similarity Track
Location :
contig_149:51559- 53004
Transcript NameFunction/comments
g11729.t1hypothetical protein

Sequence
1445 bases(100 bases per row)
CCAGTCGCCACGTGTCAGTTCTGTGTAGCTAACAGAACTAATGAACCAATTTTAAATTCATTTGTGTTTCCTTCTGCCGGTGTTATCGGCATTCAGCTTC
TGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTCTCGACGCTGGACAAAGTCCATTGCATCGAGCTGAACCCCTGGTTCAG
TTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTTCGTAGACACTGTGTTGTCGTCGCCATG
ACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTCGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTT
AAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTG
ATGGCGAACTCCGCCATCGGCAAGCAGTCCGGTCCATTGATGGAACGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTG
TCCGTCGGTCTGCGGGTGATCCGCAGTCGACGGACAACTGCATCCCAAGAAGTGTAAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGAT
CCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAG
ATGGTGCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGC
CAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTA
CCCACTTGTACTGGTGACTCCAATAGAAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCAT
ACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATA
ACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATGT
GCGTATGCGGCTTCACGTCGTCCAACAAGGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCTA
CGACATTCAACCTTCAGGTTTGTACTCAACCTGGAAGTTGTATTC