Description :
From Genome Similarity Track
Location :
Scaffold_602:5155- 7460
Transcript NameFunction/comments
Phyag_g6943conserved hypothetical protein
Phyag_g6944hypothetical protein PHYSODRAFT_307660
Phyag_g6945hypothetical protein PHYSODRAFT_533148

Sequence
2305 bases(100 bases per row)
CTGGGACCCCGTTGGCGTGACACAACCAGCTCGAAGCTCCAAGGAGCTGCGTACCTACCGTTTCCACTCGTACTTCCTGTCTCGCACTCCATTCAATCCT
CCTCGGGGACAGCTACAGAATCTTCAAGTGCTCTCCGAGAAGAACCGCGTAGACAGCGACATCTACCGCGCGTATACCCAACTCACACCTTTCGCTGTAT
CGTTCGACCACGTCGATATTGCGTTCGCTGGTGCATCGGTGCCACCGAGTCAGCTCTTGTTCTCACTGAACGCCAGCGTCGTGGGCCTCTGTGTCAACCC
CGACTACAAACCATTCGAGAACGATGAATTCGAGCCTTGTGAGGGACCACCACGTATCGTTCTGCAATCCGTGCACGTCCCGTGTCTAGGCGTGGGAATT
ATTCGCGCTGTGGATGGCGAGAAGCGTCAATTGTTCGTGTTGAGCCCACTGCCTCTTTCAGTGTTGAAGTGTGTCAACCTACTGATTCGCAGTAGTTTGC
CACTCGACAATATGATACTGTCCGCACACGAGCCTGCCCAAGCTCCGTACGTTGTTACCGACGTCGTATCATCCGATGGCACCGGATCCGCTGTCATGCA
AAGTCGCAACaacctcaaacgaaagcgcGACGGCAAGTAAAAGAACATAGAACGATGGATTTTTATTGTTTCGTGAACTACATCGATTGAGTGTAGTCTT
CTAGCTGCTGATGACACAGATCTCGTTGTGCTTAGAATCTCGATAACGTGTCAGACACTCGTCCGCGTTGATGTCCGGCTCAGGCCACGCGTCCAGCGAG
AAACCCGCCTGCTCTCGTCTTCCACTCCACCACTGCAAGATATCGCGGAGTTGTCGCCACTCGAAGGTGGTCGCTTGGTTCTGGGTTGGAGACCCCAACG
TGATGTATTGCCAAGTTGACGTCGGCAATGACAGAGACACCCCGGAGAGCAGTAGCAGCCACGGGATAGTAGCCACGCACACCAACACAGCACGAATCAT
CGGTGTGGACTGAAAATGAACTCGGAAGATCGCGACGGTTCATCGACAGGATTACTCGGACAGATGAGCTAGCCAAAAGTaaacaagttgaagcaaatGA
GGTTGAGCGCGAGCAACTCGATCCGTTATTGCTTACGTTCATGCTACGCCGAAGTCTCTTCTACTCCCGGAAGGAAAAATCTTTGTCCGCAGCCTCGGCG
TGGGGTGTCGCGATGGCGCCCATGTGGTAGTCGCCGCACGATACCCTATATTCACATGACAAAGTAAGCAGTTAGTATGATCGATCTGTAACATCATAAA
TGCCAGCCACGTACGAGGTGATGTTAACACCAGCCAGAGATTGAATCTGCACAGGCTGCAGTTGGTTCTTGCGGTCACCATGGCCTAGGCAGTTAGAGCT
ACCCTTGCCAAACGTAAAAACCTCGCCCTCGTCCGTGAGTGCCACCGTGTATTGTCGTCCGCAAGCCACCTGCACCATCTTGTGTTCGTTCACCGCCGTC
ATCTCATGCGGCTCAATCCAGATCTTAGCACCCCACATGTACAGACGTCCATCCTCagtcactgcagcagcgtggtCATAACCAGCCGCGATCTGCTTTA
CAGACAGACCGTTGAAcgcttccaccagcacaGGAATCGACTCGATGTTGTACACATCCATAGCTAGACCGCCACCAATACCCAATTGGTTCTCTATATT
GTAGCACCACAACAAGCAAGTGAGTACCAACCCCGTAACAAAATAACAATACAGACATGGTCCACGTACGACTGTTGCCTCCCCAACTGTACAGCTCTCC
CTTGTCTGTCAAGGCAAACGAAAAAtcccgtccagcagcgatcgAAACCACATTGTCCTTGGAGAAGAACTCAATAGGCTCCGGTACTTCGCACGTGTCG
GACTCGCCATTGCCCAGTCGTCCGTACTCGCCATTGCCCCAGGCCCAAATCTCGCCGTCCTTGGTGAGCGCCACCGTGTGGAACTCGCCACACTCCACCG
TAGAGATGGGCACCCCCTGGTCAaccagcgtcgtcagcagaCGCGGCGTAGATTCGTCCTTACCACCGGCATGACCCAGGCCACCGGCACCCTTCATCGT
AGAGCCTCCCCAGCCCCACGAGTACATtttgccgtcttcatccacagcagcagtgaagtAGTCTCCACATGAAACATCCACAATTTTGACGcccttgagc
gcctccaccTCTCGCGGCAGTGACTCCATCTCGCTGCTTTCGCCCAGTCCCAACTTGCTGTACTCGTTCGAACCCCACACGTACAACTTGCCATTCTCGT
CAACT