Description :
From Genome Similarity Track
Location :
Scaffold_749:5154- 10442
Transcript NameFunction/comments
Phypl_g10738conserved hypothetical protein
Phypl_g10739conserved hypothetical protein
Phypl_g10740callose synthase, putative

Sequence
5288 bases(100 bases per row)
TCACTGGCCTCCACCGTCACCGAGTATTCCTGAGACGCCTCGCGACAGGTATCGCTGCCCCAGCCACGGAAGTAGATGGTGCCTGCGGTCTTGGCACAGA
TGAGGAACGTGCTGGACttctccgtcgctgccgtgtCGGACACCGTGGGGgtcaccgtcttcttctgtcCGTTCTTGAGCGAGATGTACGTGACGTTCAC
CACGTCGCTCCACGTGAACGAAATGTACGTGCCGGCCTTGACCACCGCCGTCACGCCGTCCGAAGCGTAGGAGACCGTGTCTCCGTACGTCGGGTCGCCC
AAACTAccgcagtcgaagcagcacaCGCCGCCAGTCACGTTCGAGCACTGAGCGAAGATCACGGGGTCGTAAGTGTACGCCGCGTCCGAGGTCTTACCGA
TGCAGGTGCTACAACATTCcgcggtggagctggcagcgAACGCCTCCCAGTTGGCCGTGGTAACATCGAGCGCCAAGGCCGACACGACTGCCGTTAGGCA
GAGCGTCAGCATTTTGGATTGGCGTGAGGCCATCGCGGTCTGGAGTCTTTTTGCTGCGAAGCGAAGTGAATGGCGCACGCCCCCACAGCCGGCCTGGTGC
GCGAATGCACGAATGCGAAACTACAAAAGGATAAAAGAGGCGGCCTGTCGTGTCACGACGCGTGCTGACCGGTGGCTATCGCAATAGCCTGTTCCTTCAC
TGCGTGCCCAGACAAAGTTTGGATGCTGCTTCGTCTGGTGGTACGTACAACCGTTGTCGAGCGCGATCGTTTCCATCTCGACAATCTCAACCAGCAATGA
AAGTGCGTCTTGATCATGCGCGGAATCGCTTGAAGCCAAAGTCGAGATTCTAGGATTTGCTCACATCTGTGCAGCTTTACCACAAATTAGCGACATTGGG
CAGCAAAAGCACGCCAGAAACTTGTTGTAACCGCAGGTTCATTGTTTTCAATCGAAACTACCAGTATGGATACAACTTGCGTCACTATTAGTCTGAAAGC
CGATGCGATCTCGCAGTTCGACGACACTGTCCGTGCCTCTCTATTGTCAATTGTTGCAATCTGCAGACGCATCTTGTGTCCCGCGCACCTCCACTTGTCA
ATCGCGACAAGATCTCGACATCGTCAAAAGGAACGGGGGGTATACATGTAGTATTGCACATAAGGTCACCTCGACTGTCCTGCTCGGCTCTCTGCTGTCT
TGTCACCACTGCCAACTACTACTACGTAGTAACTACCAGTACGCAGCAGTATCCTTTCCACCGCGACCGGAGCAGGGAGACACACGTCCAAAGGGTTATT
GGGGGGGAAGCTAACTAGTTTGCTCGAGGTTGAATCGCGCTATAACGTTATTTTGTCTGGGTCCAGGTTCTCACAGCGTGAACTCGCGGTCGTCGGGCTC
CCGCGTGCCTCCGGGGGTGCGGTCCGTCTCCGGGTTGTACTTGTACGGGGCCGCCATGGCGTGTCCGTGGTATCCGCTATCGGGCGtgacctgcagcgtc
tcgacgtCGCTCTTGGCGCCCATCGGGGCCATGTTCTCGCGGTCCTGCTCCGcctgcatcttcttcttgcgaCCGGCCAGGAACGCTCGAATGGAGATGA
TAATGGAGAAGAGGGCAGCCacgccaccaccgacggTGACGAGCCACTTCCAGACGGGCCACCGGTCGCACTCCGGCGGGTTCGTCCAGTCCGAGACACA
GACACAAGTCTGCGTGCcgtccaccacctgcacgctcgcgcgctgctgatTGCAGCTGTCCACGGTCTCGTCGGCCGggacggagctggagccccCCGAG
CTGGATGACGCGGtgaccaccacgtcgtcggcgttgCACGTGTTGGTGCTCGAGGCACTGGCCTCCACCGTGACCGAGTGTTCCTGAGACGCCTCGCGGC
AGGTGTCGCTGCCCCAGCCACGGAAGTAGATGGTGCCCGCCGTCTTGGCACAGATGAGGAACGTGCTGGACttctccgtcgctgccgtgtCGGACACCGT
GGGGgtcaccgtcttcttctgtcCGGTCTTGAGCGAGATGGACGTGACGTTCACCACGTCGCTCCACGTGAACGAAATGTACGTGCCGGCCTTGACGACG
GCGGTGactccgtcgtctccgtaCGAGACCGTGTCGCCGTACGACGGGTCCCCCAGGCTGccgcagtcgaagcagcacaCGCCGCCGGTCGCGTTCGAGC
ATTGCGAAAACACCACCGGGTCGTACGTATACGCGGTGTCCGCCGTCTTGCCGATGCACGTGCTGCAACATTCcgcggtggagctggcggcgaaCGCCTC
CCAGTTGGCCTGTGCCGCTTGGAGCGCCGACAGGACGAGGCACGCGGCCAATAGCACGGATTGGAGCGCGGTCATTACTCGGGTACTAGTGGTGCCACCG
AGTCTAACTGCTGCGAAATGAAGGCACCGTCGGCAACGGGGCGAATGCGAAACTACCGCATGAAAAAGAGGCGGAGCGCCTGTCTTATCCTCTGGTTGTA
ACGACAAAGGGCCCAGCGCCCGATGGCTGCGAATGCTGGCGGCAGCTGGGGGCCAAGGCGGGTTTTTACTGTTTGGACGTGCGGCATGCACTGTACCAGC
TGgtcgcgcggcggcgataGGCTTGAAGAAAGAAGagagttgctgctgccacggGGAATTTTTGTAGTCCACGCTAATCATGTACTAAACCAGGCCAGGA
TTAGGCTGTATCCTGAAAGACTAAAGTAGCGATAAACTATGTGGCGGTAATTAAAAAATATCACAGCTTTGTGATATGCATGCCATAGAGGTTTCGTTTG
GTTGCAACTCGTGTGGCACACATTTAGCTGGTGTATCGGGAAAAACGTGCTACGGTTGAGTCTCGACTCAATCGTAGGCTATTACCTGGAGTCGCATGCC
ACCAAGGACTCCCGTGCTACAGGCTTCCGAGAGACTCTCGACTACAGAGCGAGGTGTCCGTGGACTCGTACAGTTCACTCGAGCGTGGACACATCAAGCA
ACCACAAAAGTTCTAATCGAAGTGTTCGGTAGTTTTGGCGTGTGTTTTTTCGTTTCTAGGGGGGGGTTATTAATCTACTAAGTATGTTGGTTTGATAACG
ATGTAGTTTCCTACCTTATACAAGGTGTTACACCACAGCGCTTCAGGTACACCAGTCTGCCACTCAGCAGCTATAAGGTTCTACCGGTCCGTAAAGTACG
CGCCGAGAATAGTTTTCCTTACGCCACCTAAATCTGCCACAGTTCGTGCCACAGGTGAGCTTATTTGTGGTGTGGACAACAAAATTTCCCCGTGGTAGCA
GACACTTCGAAGACGCactggacgaggtggcgaTGAATGGATGAATCAGATGACTTGGTAACATGCGGCAAAATGTGCATTTTTGCCAGTGTAGCTTTTT
GCATCTGGGGAAATGGCAATGGCTGGCCATttggtgctggcgatggcgacaGACTGGGGGGAAAATCCACAGTTTGATTGTCGGGCTTGGTCCACAATGC
ACGACTGTATGGACTGCCGGTTGACTGCCGTGCCTTTGGTGTTGGACAGCGCGGGGCTGAGAGCGGTCGGTAACCGACTCGGTTCCGTGTCCTATCCACA
TCTCTGATCGTTCATTCCATGGTGAAAGATGCGAGATCGGTCgaagccaagaagctggtcgcGCAGCGAGAGGCGGGTCCCCGACCAGCCTCTTAAATAT
TGAGCGGCAATGATCTTCCGAAGATGATCTTCCTCGATGGCAGCAGGTGTGGCAATGGCTTCGCCCGCGATGCTCGCCGTGCGACTCCTAGCAACTGCTG
ACTTTTtggtgctcttcttgctgggcaccaccagctcgatgAACATCCTaggacacgagcagcaccgacgccagATAAATAATACGAAACATGCATTTTG
TGTTTACCTACCTGCAGGTGTTCGTCACTGTGGACTTGCAACTGCTATATCTGGCTGTGTCCCTCTGTCTACAGCCGAACGGACTGCGtctcggcgtgca
gctcggcgtccgGGTACCGCTGCGACTGCAGGAACGAAACGGAGCGGGGCTGGCCGCGCGGGTAGCCGATCTGGCCCTGGCGCATGTCCTCGATgtgctc
ggcctcgaactcGGCTTCGAAGTcgaacgaggacgacaactgcgtcgtcagctgtctgcgctgctcggcggctgTGGTGGACAAGTCTGTAGACGAGCCC
TGCGAGCTCTCGTACGCGCTCAGTCCCGTGCTCACTCCGTAGTGCAGCGCCCGCGAGTTGGACTTATCCTCGGCGCTCTCGAGACGGCGGAAGCTGAAGT
GGTCCCTGGCTTCGGACGTACTGTGGTGAGCAGACTCGGCGTACTCGTCGACATTGACGCCGCTGAAGCCGAACTGCGTCGCGTTGTTCCGCGCGTGCGA
GGCCGCGCTGCTAGTGGGGGGGCCGCTGTATCCGAAACCACGATTGGTGGCTCCCGAAATGCCAAAGTTGACCTGagcagccgacgccgccgcgctggac
gcAACACCTGCGGAACGGTTCATGGCCGACGTCTGCGCAATGCGCGTCTGTTGCTTGTgcaggtcgtccacgtcgttctcgtgCTCGTCGGCCACCATTG
CCAGCTCGGGTGCCGACTCGCGCATGGATCGCTGgtacttcttctcggccttggTCTGGATCGCGCCCAGCTTCGTACTGGCGCAGAACATGAAGAGCAC
AACCGTgagcgcagcgctgcagcccgCCAAAATGAAGTGCGCCAATGCGAAGGACGGGTCCAGGAAGAACACGACGATCTGGGTGAGATAAAACACgcac
agcgacagcgtccaGTAGAGCGGCCGACGAGACGCCGGGAACATCTCGAGCGCGGACAACCACGACACGCTCATGAGACTCAACCCCGCTGAGATGTACA
GCAAGCAGAGCAGAGTCTGCACCAGCCCGCCGTCGGCACTCGACACGGCGCCAATGACACCGCAAGTGAAGGCCATCAACGACACGAACGGCAGGAACTC
CTTCAGGATCGTTTTGCGACGCACATtgtccaccaagaagctTCCGAACGCGAAGCCGGTAGCGCAGCACAGTGCGAAGTACACTTCCCAGTAGTTGTTG
GCATTGCCACTGTCGTCCGCGTTCACCTGGAGCGTGCGCCGGATCAACAGCGTCTGGGACATAATGAGACCGAAGACGGCTTGGAGCGCGAACACGATCG
ACAGACGGAACATGAGGTGGTTTTCCCTGGTCTTTTGGGCCAGCTCAGCTTTTATAAGATCCATCTCCGGGGTCACGTTCTGGCGCCG