Description :
From Genome Similarity Track
Location :
Scaffold_1043:5154- 6306
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1043-fgenesh-gene-0.1Protein Ric1
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_1043-abinit-gene-0.15Ric1 protein

Sequence
1152 bases(100 bases per row)
GGGAACACAGACAGTTCTCTCTATTTTAGCCAATCAAAATaGCCTCGGTTATGGCAGGAGCTTTTCACCGAACTCTCTTCCGCACACGCACTCGACCGCC
ATCGTCTCCCTCTCTGGTCATTCCTCAATCTGCTCTCAGCAGCTCACGACCAaGTTCTCTCGACACCTTCATCCACCTTCTCAACCATGGCCATCACGTg
TGGAGACATCCCTCGCTTGATCTGCTCTGTTATCATCCCTCCCGTCGGTGTCTTCTTCCAAGTTGGATGCACCAAGGACCTTGCAATCAACGTGCTTCTA
ACTCTTCTCGGgTACGTTCGAATTGCTCCATTCCTCTCTCAATCCCCAGTATGCaCTAAACGCCCTTGTTCTACTTCCTCTCCAGATACTTCCCTGGTCT
CATCCACGCCATCTACATCCTCATTAAGGAGTAGACACCTCTACTGTAATCCCCATGTATCAATACAGTACACAAAgACGAAGCCTTCTCCATACACTGC
ACTGCCCTCTTCCTCCGCTTCGTCATGGCTTGGTCGTGGACGAATCGTTGTGCTCTATCCATCTCCAGCCAGTGTGCACCCACAGAGAACCTGCACTTTT
AGCACATGGCTACTGACTGGGACCATCATTCTGTCAACACGGGAGATGGGTGTACACTCGAAGAACACAGAtCCcTTATTCTAATTGGTTGAAATGGAAA
CcAGATctATTTTCGACCAATCAGATgCTGCCTCCACACTTCACCTCGTCCCAAAGGAcTTCCGTCCTGCTGCATGGCCACCTCACTCGCGATCCCGCCG
CCTTCCGCTCAAGTCTCTCGCCATGGCCGTCACCTGTGGAGACATCCCGCGTCTTATCTGCTCCGTCATCATCCCGCCCATTGGCGTCTACTTCCAAGTG
GGCTGCACCAAGGACCTGGCGATCAACGTGCTGCTCACGCTGCTCGGGTACGTGCCTAATACGTCCTGCTCCTGATGACTGATGGAGGGACTGACTGACG
GAGGGTATGCGCAGTTACGTGCCTGGCCTCATCCACGCCATTTACATCCTCGTAAAGGAGTAAAACTAGCGTATGtATCGCCCcgTTCTTTtGCGTAACG
GTAGGAAGAAGCCTGCGGAGTGCGGGGCTGCCAGTGAGCTAAGTGATTTAAT