Description :
From Genome Similarity Track
Location :
contig_10:515242- 517030
Sequence
1788 bases(100 bases per row)
TGCCCCCATTGTAGGTCATGCAGCATATGCCCACTAGTGAAGAGTTGAATCATCCTTGGAGCCGGTGATCATGTTAGCAGCGAGGCAAGTGACGGATTCC
GCGCAGAGGTTGGTGTAGGTCTTGAAGGTGTCTGAAACCCACCGGCCGTGAAATTGAATCGTCATGGCATTCACTCCTGCCTGATACATGTGCGTTGCAC
ACCCCCTGCACGGAAGGAGTGCGGGCTGAAGTTCCTTGGATCCTCACCATTTAGTACAGCGGCCTTCTTGATCGCGCTCGACAGGTGTGCCGTTGAAATA
CACGCCGGATGCCCGGTGCGTCCCAGGTACATTGCCGCTGGTAAACCGGGAGGAAGGTTTTGTGTTGATTGTAGAAGGAGAAGAGCACCGAAGACAGGGC
ACATGAATGCGTGGCCTGAACGATACAGCATTCTAGCTGTTGCATGCCCGCACTGATTGGTCTTGGAACCGCGAAGCCGCATGTGTACCGATTGCGCTTC
AGTCGCCGATAGTGTCGGTTCCCCCGCCTTGTCCAGGACAACCAGGTCCTCAGCTCTAAGCACGAACCACTTGAACGAGTTTCCGCTGATGGAGACAATT
TCCGAGCGTCTCAGGAGGAAAAATAATGCCAAACACACGACCCCCCAGATGGCTTGATCGAAGGGATCATCGAACCGGAGAGTATGGAAGCAGGTTTCGA
GTATCCGAACGGAAACTGGAGCCTTGTGTCGCAGAGGTGTGTCAAGCCGGCATATCCCTTTCAGAAGCATGCGGACGTGTGGGTGTGCAATCGGAAGAAC
CCTTCCGGCCGCAGCGAAGAAGTGACGGACGCCTTGTAGCGTGTTGAGGATCGATGATCCACGTAGCGGGCCGCCAGCACCAAATCCATATTGAAACCCG
TGCACGATGAATTCAGAGAGTACGTGAATGCGGTCATCGTCGGTGACACCCGAAAGCCATGGCTGAATTCCCCGACGCGATGTCCACGCCGTCCACTTTG
TCATCGCAGCAGAGTACTTGGTGAAGGTGGAGTTGGCAACGGAATGCTCGCGGAGATATTGCGCCAGAGCACTGACAGTTCGTGGACGTCTATCGTCGGG
GATACCTGCGTCCAACCACGAGTTAGCTCTTTGAATTTGATGGCGTAAGACGGGTGAGCGGCGATGCGTGAACCGGCGTCTGCGCGGGTGTTATCGACCC
CAGCGATATGGGAAGCCGAGAAACGGAGGTTGAGAGAGCTCTCCCAGTATCCCAGGAGCCTGATAATGTCTTGGGCACGAGTGTTACGTGACGCGAGGCG
ATTTTGCCAGGCCACCGCCGATGTATTGTCGATACGGAAGTGTATGTGGAGGGGGCGACGTCCGTCAGCGGCACACTCGGACCACCGCGGACCCCATTCG
TGGGTAGCGAATGCGCAGGAGAGCAATTCCCGGAAATTGATGTTAAAACCATTGGCTTCCCCGGTCTTGAAGCGCTCAATAAGCCGGAGCTCATGGGATG
AAAACCGGTAAGTCAGCGCAATTTTGGTCTTCGTATCGAGGGCACACAGTCCGTGGTCGCATGCGTCCATCTCGACGACCACGTCGGGCTCCGGGAGACT
GTTAAAGTACTCAAGGGCGACGCCATTCAGGAGCGGGGAGTGAAGAATCTGCCACCACCAGAGCAGATCTTGTTTCATGGAGTCGCATACCGTAACATGT
CGAAACCTGTGAAGGTTAATCTCCCGAAGCCGTAGGCGCTGGAGAAATGGGCGCGCTGCCCTGATGCATGTTGCGACGTGACGCAAGC