Description :
From Genome Similarity Track
Location :
Scaffold_8:5152- 6195
Sequence
1043 bases(100 bases per row)
AATGTCTACCATAATCTACCTTTGCTGATGCTGTACAGTACCATGTACATGTACCACATGTCGCCAAATCTATGTTATTTAGCGACTGATAAATGTCGCT
TTAAAGGGGGAATTATCATCTGAGTGGACATCCACTCAGACTTTCCGTTGAGGGTCTCCCTACGAAGTGTTCGTCGAACACACTCAGATTAGCGTTACGC
ACATTCGGCAATAGCGTTCAGCACGGTAGAGCTCTTTCTCATCGCCTTGATTGTTAAGTCGAACAGCAACTGCGCCTCTGACCCGAAGAGTAGGGCGTCC
TCGAGCGAGAAGACCGGGACAAGATCCACCCGCACGTGTCCGCGCTGCCACGACAAGATGAAGATAGCCCAAGGCCTCACCAATTACCTGGTAAAGAAAC
TCAAGCGATCACGCTTCTGTCGCTGCCCCTAACACTGTGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN