Description :
From Genome Similarity Track
Location :
Scaffold_862:5151- 6654
Sequence
1503 bases(100 bases per row)
TAGCCCCTTGGTCAAACTTGCAGAGCAAGTCAGCACAATTCAAGTCTGACAGTGGAATCCAAGAGGGCTCTTCGTAACCAAGCCATTTCACCAAGTATTC
TTTGGTCCTCTTTGACgTTTGGGTtCTTTTCACCCACCTCACATCCAGAATCTTCTCAACCTCGAGTTCCCCGGCAGACTCATGAGGCTCCCAACTGTCC
TCGGGTAAgAGTGCTGCATCGAACTCATCGTCTTCACCAACCTCAAGGAGTCGGAGTGGGGGTCTTTCAGGGATATGAATGCGGGCTTTCAGCCGACTGA
CgTGAACCCATGGgAAAAaCCGATATTCAACTCCATCCACCTTGAGCTTGTACCGAAACTCGTTATCGGAATCCTTTTCCACAATTCTGAAAGGCCCGTG
CCACAAATGTTCGAGTTTTtATGTGAGACCTGGTCGAACTCGGGGTATATACACCCATACCGCATCCCCAACTTGAAAACTTCTAGGGACCGTGTCTGGC
AGATTCCGCACCTGGAGATTTCGGACCTCTGCTCGAGCTTCTTTAGCTTTCATCTGCAGATCTCGAGCCCAGGCCCGGACAAATTCGGCTTGACGCTGAA
CTTGGATTCTCCAACGGTATGGATTGATGTGATCCCTACGTGTGGATGCTGGACCCAACATGGCAGCCATGGTCGATTGGGCGTCCCACCCATGCACCAa
GAAAAaTGGAGTTtCCTGGCGGGTGTAGTCGTAAGACGTGTTGAGTGCGAACATGAGCCTTTCACAAATCTCATCCCAGTCACCTTGCCGGATCTTCGAC
GTAAGCTTTGGTGGATCTTACGACAGTTTGAACTGATCGTTCTTGTTGCCCATTTGCTTGGGGTCTGTACGCCAGAGTAGCTCTTTGTTTGCTGCCGATC
AGATGCCGAAAAGGTCGAAAGACTTCAGACATGAAAGATGGTTCTTGGTCATGCCGGATCACAGAGCTTGCACCAAATCGTCGGAAAACCACTTCTTCGT
CAGCCTCAGCCACATCCTGACCTGTCGTCTCGGCCATAGGCTTGCACATTGCGAAACCCGAGAGCATGTCTTGGAAGAGCAGCAGTGCCGTGTTTCCTCG
GTCAGTAACTGGTAAAGGCTTGACAAAATCCATGGATACTACGTGGAATGGATACTCCGGCATGATGTTGCCTGGGGATTCCCCCGGATTTTGGGGTCTT
CCTTTGCCACTCTCACAGTCGACGCATCTTCGAACAAAACCTTCAACATCCTTGAACATACCGATCCAGTGGAACTTCCTTGAAACTTCCTCATATGTCC
TCCCGACGCCTTGATGTCCACCTTGGAAATCCGAgTGACTCTCGTGTAGAACGTCATCTCGCATCGAGTGCGGAACCACAACTCGGGTTTCTGGAGTCCT
ACCAGTGGGTCGTCTCTTGGAGACTGGaGgTACGTAGAATAGCGTTTCTTCCTCATCTAGAACATATCGTTCGGAGATTTTGGCAAAGTTCCTGGCTTCT
GCC