Description :
From Genome Similarity Track
Location :
Scaffold_483:515- 2645
Sequence
2130 bases(100 bases per row)
AGCAACTTTACCGACTGTCGCGACCATCCCTTCTGCTTCTGTGCTCTGCGACGGAAAATTCCGAATGACTGGTGTCTGGAAACACTCAGACATAACCTTT
ATCATTCAATGTCCAGCTCTAAAAAAAATGTTTTTGAAAAATGTTCTATGTCACCTGTGCTAAACCCAGCCCTACATATGGTGATCTTGGTCAATTTCGT
CACTTTTGGCTGACTTGATCTAAGTATGGGCTAGGATGGGCAAAAAAACTGGTTTACAATTTTCAAGTCTAAAATGGCCTTTTTCAGCATTATGCTGGAT
ATGAAAAGGGTCTAATCTGCATTACGCAGCAAGCCGGACTGGAGGGGTTATGCACTCCTTTTTTATTGGCAGTTTACACTTTTTTTTATTAAAAAGTTGC
ACGAATAATTCACGGAAACTAATACCTGTTTGAACGGCGGGTAAATGTGGACAATACATCGAAATACGAAGAGTGAAACACCCGATCCGTATCTACTAGT
AGGTACTGTCTGAGAATTAACAGACTGTCTTCAGTGTTGGCTGCTGGTACAAAATCTAACCAAAACGAGCAAGTGGAGGATCATAAGTTGGTATGTTTGC
GGCTCCTTACCAGCTTTGTCCTCGCATTGTACTTGTTTAAAAGTGTATAATCAGCAAACGACAGCGAGAACATCACTGTCGGGATCGAGTTGAGCACGAA
ATCCGAGATTCTGATTTAACATATGAATCTATTGTGCCCTCGCCCTAGTTGCAATAACACCTTGAAATAGCACCTCATGGCAGGCTACCTTTAATATTGA
GCTGAACGAGCTGTGACGCAATATTTTTGGGATTTTTGGAATTTTCTCTCAATTGCCAGATAAAAGAGCAGAATAGCCAAATGTACAAGTATAAGACCGT
CCGTATGTGAAATGAACGCCATTTAGTGAACCGTAGTGAGCAGGTTCAGCAGGAATGCCTAATTTGGTTTTAAGGAACCGGTTTCAAGGGGTTAACCCCT
TTAAGGTTTTGTTAATACATGTAGTAAACCTCGTGTGTTTGATAGGTCGATGGCCTTTTTCTTATATATAATGATAAAAAAAGCATCATTTGACGATTTG
TATGTCAAGTTGATTGGCTAATTTTGAAACGATTATGAATCAGATTGCTTTTAGTAATATATCGCAGTAATAAGGGTATTTTTAAGTTTGATTCTGGTTA
TACTTGACGATGCAGCCGTCGATGTAGTGATAGTTTAAATGAGGTTATTAACGCTTTTGTAGGGAAGTAGCCTTGCTAAAAACATGATTCGGGGTAGCAC
AAATAAAGAGCTTAACAGTGAAACTTGTAACAACTACATTTAGCTGGTAGAGCGAAAGTTATAGCAAGTTTAGTAAACGCTTAGCTCAGTAATGGACCGG
AGAAGTAGGTCCGATTACAGACAGTTCACTCCGTATTCATAGTGTATTTTATTCATATTGAAGGGGATTCCTATCGCGGGATGTACCCCAATAACGGATC
TGCGTTTTCCATCCCACGCGCAAAATGGTAATTCATACTAATTGCTGCCGATTATCTCCTCGCGTGTTGACTCAGCAGCCACCACATTCATCTTGCGACT
GAGTTGCTGTTGACAGAGCGCCGGGTTGTTAAAATATTTCGTTCATGGGGGTGATACTGGCTGTCGTCGACGGATTTTTTTAGCGAGTACCGTACGAGGT
CATTGTGATAATGGCCGGAAACAATGGTGAAAATATACGCTACTATTTTATGTTGACCTTCCGGCGGACAATTGGGAGTTGCATATAGTTAAGTACTCAA
TACTAAAAATAATTGCCTGGCGTTGTATCCCATTTACTACTAAGGGTATGAAAGGGAAATACTGCTGGTCATTGGTAACCTTATATTTATTGATTGGTAT
TAACCTTTCGAAACCGGGTGCAGGATTACCATTTTCGTTAAACTGAATATATTCAGTTTAACGACTTTTAGACTTAAAGTTTGTATGACATGTCTTTTCG
CTCGCCACAAGGCATACAAAATTTAAGACAACCAGAATGCCTGTTTTTGTGTGGGTCTTTTTCTCTCAAGAGGTTAAACGGGGCAACATTTGTCTAAATC
TAAATATCAACTTTGCGAGGTTTGTGAGAT