Description :
From Genome Similarity Track
Location :
Scaffold_1876:515- 2572
Sequence
2057 bases(100 bases per row)
CATTCAGTAAGCCGTGATATTCTGCATCGTTCACAGTGACATCACTCAGGATGAAACCTTGTGCATCCAGTACGCTCCAACCAGGCAGGCTCCACAGGAT
GCATCCGCAGCTTCCTCGGCGAGTCGACGTCTTGGCTGCTCCATCGAAGCTTGACACAATCCCCTCAAAGTCAGCGTCCAACATCTCCATGCTCACCACC
GGTGGTGGCTTGACCCGCCGCTTGGCTGGAATCAGCGACTCTGCGATCCGGTCCAAGTGCTCTCGGGGGGTGATACCCGCACCGAGTATAGCGGCTAGAC
CGTCTTCATCTCGCTGAATTCGGCGAACTTCCAGGTCCCACTCGGAAAGAGTGACGCCCCATGGTACGCAACGTCCATCCGCCGACTTGGACTGAATCAC
CCACTTGAGTACCGAATAGCGGGTGTACACGATTATCGAACATCCTTCCAGGATCGTCCTGAATACATTCAGTACTCTCATGATCGCGATGACTTCCTTC
TCCGCAACGTGATATCGGACTTCCGAGTCATTCAGTACACGCTCCGTGAAACGGACGGGCTGAATCAGCCCGTCATGCTCTTCACCGAGGACTGCACAGG
CTGCCCACTGGCTCGCGTGAGGAATGATGACGAACGGCTTGGTCCGGTCCGGATGACGTAGCAATGGGGTCGACACGATCTTCCGCTTCAGGATCTCGAA
CGCTTCCTTCGCCCTCGCCAAGTCCCTACCGGATCGCACTTGGTCGTCGCTCAGCTCGTACAGGACTGCAGCTACCATCGGGAAATCCTCTATGAACTTA
TAGTAGTAGTTCAGACTGCCGAGGAAGGACTGGATCCCCTTCAGAGTAGACGGGAATGGTAGATCCAGTACGCCCTCAGCGATCTTCGGCGTCGCCCTGA
GTCCTTCTGCACTGATCTCATGAGAGAGATACGGGATCGAGCGCTTACCGAATTCACTCTTCGGTAGACTGACAGAGATGTTCCAGTACCGCAACCGAAA
CAGTAGCGCATCCAGATCGATGAAAAGTTGATCCCACGTAGGCGCCCCATGCGCGATGTCGTCAATGTACGAGCTCCGTCCTAGGACAGGGCCCATCTGC
ATCGGCGCCGGGATGTTACGTTGGAACACAGTCATCCGGTCTGTCAGCGCGGGTAGACGTCGGCCAGACAGGATTTCGTCGTCCGATCCGGTGTCGCTCC
CTGCGACGTTGTCCTCTTGCAGCTTCAAACCCAGATAATCCAGTACGTCCTGATCCACCTGAGCTTCCTTACCAGGTGGTAGTCGAACAAAGCCCCACAG
ACAGTTGTTGAGTATCTGCTGGTACACCAGCGGAGCATTCTTCAGACCAAATGGCATGCGTCGCCACTGGTAGTGACCGAATGGCGACACGAACGCCGAG
ATGAGCTTGGCTCGCTCCGTCATCCTGATCGCCCAAAAGCCGCTGGCCATGTCCAGACTCATAAACCACATCGCGCTCTCGAACCCGATTAGCAGGTCGT
CAATGAGCGAGAGAGGATAGTTGGACAACTGGATGAACCCGTTCACGATCCGGTAATCAATGCACATCCGGATGTCGACCCCGTTCTTCTTCAGTACGAT
CACGATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAGTTTCCAACAACTTCTTCAGCAACGCGTACACCTTCATCGCAAGGTGTGGCGCG
ACCGAGCGTGCCCTCTGTGCGACAGGCTTAGCGTCTCCCACATCCAGATCGCAAACGACTCCGCGAGCTGGGGCTGGTGCCGCATTTCCATCACCTAAGA
AGATACTTCGGTGGTACCTCAGGATGCCACGTAATCGGTGTTCGTCATCCGGCGTGCTCACGCCAGGTTCGCCAACATCAGCCTTGTCAATGTCGCACTC
GGGACTTAAATCCTGCACCTCCGGGAGGAGTGCGAGTTGGTCTCGCAGCTGGGAGAGCAGATCGCTCCTTTCATGAATGTACACGGCTGGTTCAAAGTCC
AACTCCTCCACACTTAGTCGCATGACCCGCTCGTACTCTTCTTTGAGTTTCTGCACC