Description :
From Genome Similarity Track
Location :
Scaffold_3364:515- 1870
Sequence
1355 bases(100 bases per row)
ATCTGACTTGGTTAGTCGGAACCGAGTGGAAGCGAGCCACTCGTCTGTCCCGGAAGGGCCGGACCGCGAGGGAACCACCCTCTGCGCAGGCCATACAACC
GCCGACCTAACTCGGCGATTCGTTGTGGTTTGTGTAAGGAATCCACATCTGACGATATTTGTGTGTTCTACTACACCACAATCGGGCAACTTGTTGCTAT
TACAGGCAACCGTCTGGCGGCGTGCGAAATTCGCCCCAGAATCGATCAGGATTCTAAAGAGATGATCGTATCCCCGTACATATCCGTGTACTACGAGCAA
CCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCTGTGCGCCCTTCATGAAAACTTAGTTCT
TCCCATATAAGGCGCCTCGCCCCTACTGGTTCCCAGCGTTCCCCTGTCCCCGGGGTCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGAAAGGA
CCGTCTGCGGAGTCTTTCCGCAGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCGCAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTCAA
GTGTGAACTGCTGCGTTGAGGCTTGTTCGGCCGGGAGACGACAAGGAACTAGCAGGGCATGCTGAGCCCGGCGTGCGCGCCTGGCGATGGGCTGTATTCT
TCCTGGAAGAGCCCACTAGAATCGCATCTTCAAGGGTGCTTGACTGTACCCCGGAACAGCTGAGTGCGCGCTGGGCCCACTCGAAGGCCGTCCATGAACA
CAGTCATCTTGATGTGTTCGTTGAGTGGGTTTTCCACTAGAGACGCCGTGAGCTCCCGTATCACTTGGACGTACTCGTGCAGCTCCGTCTCCCTTGTTTG
TACGAGAGGAAGTGCAAGCGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTTCACACAGCTGAGCCCCAGGATGTGAAAACATC
CCAGAGGAATGTTTGCCTCCCGGCGTGTAACAGCAAAATTCTTAGTCACGAACCGCTAGGGTTGGGAGAGTGGCAAAAACCAACACGAAAGTTGCTCGGT
CGAGATCAGAGCCGCGTCCATCGTGAGCTCTACCTCTCGGACCCAGAAGTGAAGGTTCTCACCTTCCTTCCCTTCATACGGCTTCACCTTCAGCCGTATT
GGCTTCGGGTGTGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGCCCCTGCTCGTAAGCGTCAAACGCATTGACGC
GCTCGAGCTGCTCAGCCGGTGTTGACACCACCAGGCTCCGCAGGGCCTCCATCCC