Description :
From Genome Similarity Track
Location :
Scaffold_553:5149- 8323
Sequence
3174 bases(100 bases per row)
AAGAATTGGACAAGGCTTAGGTTATTTCTCGCTAGACATGGCGAGTGGTTTTTGATATGTCGGTATAATTGAAAGGTCGAGACTAATTTCGGCGTTTATT
ACCCCACTGGGTTTGTTTGAATGGCTGCGGATGCCGTTTGGGCTCAAGAACGCGCCCTATATATATCAGCGACTCCTGGATAACGCGTCATACGGGATTT
TACGAATTCCTCCAGGAGTAGAGACAGATGGGTCGAAGGATTTTTCAAGGTGGGAGAGCCAGATGAGGAGTCGGTTTCCTCGATCTTGGGTCAGAGGTCA
TATATAGATGACATTCTGATCCCCGCCGAATCCTGGGACGTGCTTTGACAAAACTGAAACGGCTACTGGATGTGTGCGAATACTACAATTTGTCAATCAC
CAAGGTCAAGAGTTCGTAGGGATATCGGAAGGGCGACTACCTTGGGCATCGAGTATCTAGTGGAGGACTTGAGGCTTACTTGAAAGACCTCTAATCTCTG
GTCGACCTACCCTTACCAATGACACTGAAGGCCATGCAATATTTTCTGAAAAGCTTGAATTACTGTAGCAGGTTTATGAAAGACTACGCCGTTTATGCAT
TTATTCTCTACGAATTGAGAGAGGTGGACTTTCATGCCCGACAAAACCAATTGAAGGGAGATAACAATGCCACTTTTCAGGATGAAAATGAAGAAAGGTG
GACCCGTGTTCAAGTAGCCTTAGCCATGCTCAAGAATAAAATTGCCACAGAGCCAATTCTTGGACATTTCGACCCTATTTGAGAAGCTGTGATTATTGTA
TATGCAAGTAAATGAGCCATTTCGGCGTCACTAGTGCAGGATTATGTAGGACTGCTTATACCGGTAAATTTAACAAGCAGAACCCTCAAGGCTAACGAAT
AAATTACAGTACAGTGGAGAAAGAAGTATTAGCATTATTGCGTATAATGGAGACCTGCTTCACTATGCTGGTCCCTCGCCCCCTCAAAGTCTTGACTAGA
CACTCGACATGTGCGTGGTTAATGAAATCTGCCGGCTTGCAGGGGCACTTTGGAAAGTGGGCGGCTTTCTTGTCTCAGTGGACTTTGGAGATGTGAAGTG
TAAAAAGGTGAAGACCAGGTACTGGTGGCGTTGGAAGCCAGTATTAACCCTCGAAAGAGTGTCGACTCAATTGTGCCGTCCATTGCTCCTAAGAAGCAGG
CGAGGCTGACGATCGACCTACCTACCCTTACCGTGGAACCAGACGAAGAACTATGCGTAATGAGTTTCAATGGGTCAGCCCGTGTCAAGCAAGGAGGTGA
GGCTTGTAGCGATATCGTATTAAGACTCCCAGCTTGGACCATATTCGAAGCCGCCTCGAAATATCTCGATTCATCCACGATAAATGAGGCAGCATATGAG
GGTACGCTGCTGGGATTTGACTTGTTGAAACCGTTGGAACGACGGCGGTTGATTATCTGGAGAGACTACACTTTAGAAGTGCGGCAGATGCGGGGGAAGA
TTTGGTGTAAGGCCTCGGGTGTATTACCGCAACGAGCCCGGAACTTAAATGACCTCCAATCGGGGCCTTCTCACGAAATCCTGCATGTGAAACAAGGTTG
GAATCAGAGCGCGGATCAGTTGGCTAGTGCAGCCTTGCACCAGAAAGGGGGATCAAGTCGATGCCGAGTGAAGAAAGACTAGGCTTGGAAGCGATCAATA
GTCTACCGGAGATGCTTGTTATCTGAAGACCAGAACCTCTATACCAAAATATTTGCGGTGATTCGGTCGCGGTCTCCTGTTAAGATATCCGGAGAGACCA
TACAAGAGGAGGTAGTACAACGACTCCGCATCGACCGAATTCGAAAGGCGCAAGAAAAGGAGAGCTGGGTACGAGATTTAAAAAATGCATACTTAAGGGC
GGACTGGAGTGACCTGTCGGTGGAATCCGCTAAAACGTGTAGCAAAATGTACGGAGATTACGATGTAAGCGAGGAAGGATATTTGGTTTATTGTCCAAAC
TACAGAGTCGAGGGAGAAGGCCGTAACATGAAGGCCAGACTGGTGATACCTCAAAGTCTCCAGACCGACTTTCTCCACCACTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCGTTTCGGGGAGTGCAGAGATATGTGTGTTCTTGCAT
GGATTGTGAGACCGGAAAAGGTGGACCACCCTACAAGGGAAGAGATCTGGGAATATTGTGGCGACTTATCCTTTCCAAGTTATAGCGTTGGACCATATCC
CGTCTCTCCCTAAGTCCTATAAAGGAAATACAGAAATTCTGATATGGGTTAATTAATTCACCGGATATGTAATGGCCAAGGCTCGTGCATCGCGGACAAC
TCAAACGGTCGCTGAGGGATATGAAGAGTGTGTTTACCGTCGTTTTAGGGCTAGCGAAGCGATCCGTCACGAAA