Description :
From Genome Similarity Track
Location :
Scaffold_682:5149- 7623
Transcript NameFunction/comments
Phyta_totarag10146conserved hypothetical protein
Phyta_totarag10147hypothetical protein

Sequence
2474 bases(100 bases per row)
agcaattgcaagACCAGATTCAGGTGGAGCTGGGGGACGTCATGCTCGCAGATATCTCGAACGCGAAGCTGGTCATTGTCTACGCGTTCGCAGAGTCGTT
GGCGGGCATCGCAGAGAGATTGAGAGAGCAATTGAGAGAGGATGCGAACGTGCTGTCGATTGGGGTGAGTTAGTGAGtggaaggaggaggaggaagttGT
CCTGGGGATTGActtgtttttgttgttgttcaTGTTGGGTTGTAGTTTCGCGTCCCGGAGTGGAAGCCACATTGGAGTGAGTGTGAAGGAGGATTGCGCT
GGTACTTCTACCGCATCGGCGACTGCGTTTGAAAACTGATGCAAAGTCATACTGGAGCTCATGACGTGGCCGTATTCAATAATGTTATACTTGTACATGT
TACGATTCGTCAAGTAGCTTGGCGAGTCTTCGTTTTACTTCCTGTACCTCGGCTAATACCAACCTATCCAGCTACACACATTAACATCAACACACAAAGA
GTTGGACGACTGAATGATCCTCCAGCATTGCAGCGATACGAATCCTACCTGTTTCCGTCTCTCCTCAACGCGTACAGCTTTGTCAATGATAGTTTCGCTA
GCACTCGTCTCCAGCGTACGTTTTCGATCGGCGAATTCCATGCGGAGTAGCTTTGACAACGAAGCTGACGTGGGCAACTGGTTTGTGGACTTTAGACGAC
GTGCTGTTTTCTTCAAAATtctcttcttgatcttcttctttgttTCTTTatcgagagcagcagagGCATCGGCTTGACTGGCTAGTTGCGCTGACACAGG
TCCAGTCGACGATTTTCTCTCAGTATTTCTCGCAAGACTTCCTAGATCGGAACTCGAGGAGGTGTGTCGTCCCGCTACGTCCTCCGAGGATGCTGATACA
CACGATTGCCAAGCACGCAGCGACGTGGCAGATCCTTTCCGTTCGCTAACTTGCGCTTCACCGATTACGATGGTtcgctcagcagcatgcagTCGGTCTA
ACATGTTGTCCAGCTCAACATCCACCACCTGCCGGGTCGTTTCTGGcctggcagcgacagcatgCCGCCTACGAAGCCCTGTTTCTTTAGTGCTGTCCTC
AAGAACATTTTTACCCGGTAGTGGCGACGATGCTCGTCTGGCGTCCTCGTTGTAGTTTTCTTCTTGATAGAAATCTACCTCTGCGCGTCGCCTTGACAGT
GTGCTAGACCGTCGTGTAGTGTCGTGCTCAGCTTGAAAGGTACCGACTGTAGTAGTTTCTGTATTGTCAGCGATGGCTGACTGAGGTCTTTCTGGGCTCT
GCTCTGGTGGTTCCGCAGGTTTGGCAGTTTGATACTACAAAAACAATGTCAACGATGTTACGAGGCTTTCGGAGGAAATTCGGTGAGAATGTACTCACTC
ACCTCGGCAGCACATAGTACACAGACACTATCAGTGGCGTAGATCTCTGTAAACCCATGGCGAAGGCAAAATCCGTCCTGTGACTTCTTCGGTTCCTCCT
GGAAGACACGAAAGACCTTGCGCTGCGAAAATAACGCTTCCGATGCAAGCTCTCGGAACTCTACAAGTGAGGAAACAGAGAAAGCGAAGTCAGTTGTGAT
GGTACAGACCGACATGAACAATCAAAACTGCAACACACGTTCAAGACGCATTTCGCCGGAGCCCACTCGGTCAAACCGTGCTAGTGCGTCCATCATGACT
GTGCTCCCCATGAGAGAGTGAAGAATCGTCCGTAATGCcagacgccgctgctgctcgaccaGTTCAGCTAAGACAGCGACGTCCTGCTGTGTAAGCCTCT
CACGCGTTCCAACGTCAGGATCCAGTTGCTCTTCAATACCCAGATACTCTTGTTCTGGGAGGCACTTCGCGAGCGAGCGTAGTTCTGCAATCTCGATGTA
TCCGTTATCCAGCGACTCCATTTGCTCAAATAGCTCGCACAGTACAAGCGCCAGACTTTTTGCGCGAAAGTCTCCGATGTCTGTCGTGAGAGTGACGCTA
TGGGTTTCTACTATCTGATTTACATTTAAGTCGGGCTGCGTGTCAAGTTGCGGGGTTTCGTCCACCATAGCATCACCAGTTGCAGCTTCCCAGCGTCGAA
TTGCGCGATTCCAAACCACTCGGCGCTCGGGTAAACAACTGCTTTGGGTACGCGGAATGGGGCTCCATCCGCTGTCCTGTTGCCAAAATGGCTCTAGCAG
AGACTCCAAAGCACCGGCATCCACTCGAGCAGGCAATGCTTTGTCCTCGATCAAAACTAGCAGAAGTTCTCCTAGCAACGCTAGCATCGGGAGGCCTCCG
GGTTTGACTTCAGCCAGTAGCCGATCTACTGAGTACCTCCGTGTGAATTGAAATGTAGCTGGACACTTCCAGTTTGACCAAGACATCGACGGCAAACACG
AGGTTGAGACGGGGTTTTCGAAGCTTGCATAGCGCAGAATTGCTGCGAGCAACACTGTGGGGAAGTTGTTGGTT