Description :
From Genome Similarity Track
Location :
Scaffold_608:5149- 7154
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_608-snap-gene-0.5Glutamate-cysteine ligase catalytic subunit
Pytve_DAOMBR484maker-pve_contig_608-snap-gene-0.7Gene of unknown function

Sequence
2005 bases(100 bases per row)
ACCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGGGCTTCATCCATATGGACTGCATGGCGTTCGGTATGGGCATGTGCTGCCTGCAGGTGACGTT
CCAGGCCAAGAACATCGGCGAGTCGCGGCACCTGTACGACCACCTGGGCGTGCTCTCGCCCATCCTGCTGGCGCTCACGGCCGCCACGCCGATCCTCAAG
GGACGGCTTGCCGACACGGACGTGCGCTGGGCGACCATCTCGGCGTCCGTGGACGACCGCACGCCGCAGGAGCTCGGCGAGGCGGCGCCGCCGACCGACG
CGGCGANNNNNNNNNNNNNNNNNNNNNAGGCCAAGTACGCCAAGATGGCTGGGGGAGGCGCCAAGCGGCTGCCCAAGTCGCGCTACGAGGGCATCTCAAC
GTACATTTGCAACCACAACGGCGGCAAGGATCCGCACACCAAGACGGCCAAGTACAACGACGTGGAGGTGCCCGTCGACGAGAAATCGTACGCGACGCTG
CTCGAGAACGGCGTCGACTCGCTGCTCGCGCAGCACATAGCCCACCTCTTCATCCGCGACCCGCTCGTCATCTACCAGCAGCGGCTGCACCTCGACAACG
AGCTCGAGACGGACCACTTTGAGAACATCCAGTCGACCAACTGGCAGACGGTGCGCTGGAAGCCGCCNNNNNNNNNNCCGCTGCCCGTTGGCGCCGACGG
CAAGGTGTCGGCGGAGGCGCAGCACGTCGGCTGGCGCACCGAGTTCCGGTCGATGGAGATCCAGCTGACGGACTTTGAGAACGCGGCCTTCACCGTCTTC
ATCGCGCTCGTGTCCCGCGTCATCCTGACGTTCGACCTCAACCTGTACATCCCGCTCTCCAAGGTGAACGAGAACATGGAGGCCGCGCACCGNNNNNNNN
NNGGTGCTGGACGAGAAGTTCTACTTCCGGTGCCACTTGGCGCCTCCCGAGGCGGGCGACTGCACGGCCACGAGCGGGTGCTCGCTCCACGAAGACATTG
ACCGGTGCGAGCTCATGACGATCGAGGAGATCATGCTCGGCAAGGGCTCGTACTTCACGGGGCTCATCCCGCTCGTGTACGCGTACCTCGACTACATCGA
GTGCGACGAAGCCACGCGCACGATCGTGTCGCGGTACCTGTGTCTGATCGCCAAGCGCGCGTCTGGCGAGCTGCCGACCGCTGCGACCTGGATGCGCCGC
TACGTGCGCGCTCACCCGGACTACGCGCACGACTCGGTTGTGACGCCCAACATCGCGTTCGACCTGCTGACCGAGTGCCAGCAGATCGGCGAGGGAGTTA
AGCAGTGTCCCGAGCTGCTTGGCGAGTTCAAAATTGAGCCCGTCCGCGGCAGCGCCGCCTACCAGGTGCCGCTCAAGAGCGGCAGCGTCGCGGCCAGCAA
GCGCGAGTTGCTGCTGCACCGGTACGTTGAGCGCACGACGGCCGGCGACATCTGCCTGCACTGCAATGACTACTGAGTGTGAGCACGAGCGCAAGATGCG
CCAGATACCGGGAAACAGCCAGAAATATAGGGAATAGTGTGTCATGAGGGTCGTACCCGCAGCAAAAGCTGGCGACAGCAGACGCCGGTCCGACCATAGT
CCAATATATCTGCATTTTCGCGCTGTCGATCTCCTCCTCTGCTGCCACAAAGCCCGACCTGGAAGCGTCTAACGACGGTAGCGGTGGCGCTTGAAGTTGA
AGTACAGATGGAGGATGCCGCGCTCGAAGACGCTCTTGAAGCCGCGCTTGTGCGAGTACTCCCACTCTCGGTTGACGATCTTGAAGGCGATGTCCTGGTA
CGGCGGGCCAGCCGAGAAGCGGATGATGCAGAACTCGGACGAGTTGGCCTTTTCGAGCGTGAACCGCGGCGCCGTCGACTTGTCGAGCAGGTCCGGGTAA
AACAGGTTGAACTTGTAGCCCTGCACGACCTTGGGCGGCGGGTTGTCGTGGTCGTAGTGCGTCTGGTTGTACTTGTTCCAGTCGTAGCCCGTCTTGACTC
GGTTG