Description :
From Genome Similarity Track
Location :
Scaffold_44:514824- 521234
Transcript NameFunction/comments
Physo_136309hypothetical protein

Sequence
6410 bases(100 bases per row)
CGGCAGCTTTTCCCCTAAAAATTGTATAACAAATACAAATTAGCCTTAAAAAATAAAAATTAAGAGAGCAACAAAAAGGAAAACTTACCATCAGCTCGAA
TCGTGAGCACAGCCGTCATGCGGCCGGTGTGCTTGGACGTGTTCGCAATCCTCGCAGCGTCCCGCCGACCTCTACCAGCCCACATCCGAGCCGGAGGCAT
GTCAAAATCGATGGCAGTCTCGTCCACGTTGTACATGCCCTCCGGCCCGTACGCGGCGTGCGTCTTTCAGAAGTCCAGCGCGAACTCGGCGCGCGTTTGC
TCTAGCTCCTCGGTGCTTTTCTTTGCCGTTTGTGGCTTCTGGGAGGTAAAACCATGCCTAAACACGCAAATAAAATTATCTGTTAGGAAACTGATGGAGT
GTTAGCAAAAACAAAATTATTTACTGAATTGCGAGTCTCGACCATGCGCTCAAGCGCCTAGATGCCGCTCCGCTTCCTTTGCAGGTAGTCCTCGACCCAC
TCGGTCTCGATTGCCCACATGAAGGACATAATGCCACGTGTAGTGAGGGCCTGTACATTATAGCATAAAGTTTAACAGTTAAACGCTACAAATTATGAGA
TTCTAAAAAACCAAACTTACCTTCTCTTCGCGCCGCACGTCCTTCATGAAGGTGACGACCGCAGGAATGTCGGGAAATACTTCCCTGCGGCCCTGGCCCA
TCAGGGACTTAGAGGTGGAGTGGCCAGTGAAGCTAAAAAGCTTTTCAGCTTGCTTCCACCAGCCATGGACAGTGCCCCGAGCAAGTTGGAGCTCGCGGGC
TGCCTACTCCACTCCTACATCTTCGACGAGGCGGACCGCTTCGCGCTTCTCGCGGACGGTGTAGCTCTTCTGCTTCTGCTTGGGCGGCGGCGTGTCCTGC
ATGGCTCGAAAAACAGTTTGAGCGGCTCTGTCGACCAGCTCCAAATTAGGCAATGGCACACGGGGATTTACCAGAGCCATTCAAAAATTAAATCGCGGTG
ATTGGCTTATTTTTATGAATAAAATAAATTTGATTGGACAAAATCATCGCTTGTTTTGTATGGACATGTCTATGGAATGCCGGGTTTTGCGTTGCCGGAT
TTTTCCGTCGTTGTCTGTAGTATTACGATTATGATAATACGGGTTACCAAGGAAATGGACAGGGCAGTGGCAGAACAGAACATGTCCTCATTTTCAAAAA
TTTAGTAAATCAAACTTCCTATATAGTTTATCATATACGGAGTTGGGGTGTCATCCATAGCTGGTAGCGCGATCAAAATGGTTGGTCGCGCAATCAAGGA
AGCGTTTTTGTTGAATACAAATATATAGTAAAGTAAACATCCTGTTTCAACAGCTGCTCGAACACACGTCTTGCAGCGATACAATGCTCATAAAATGGGG
TCGCAGGATGCTGGTCAAGATCGGCCTTCACAAATATGATGCAAGCTGGGATGAGCGCGCGCGAAGTCAGGCGATTGAAGCTGCTCAACAGTGGTAACAG
AGTGCTTACAGTAATCTGCTTCCTCACCGAACACCTGATACTGTATGTATAACTTATACATGAATAGTATTCATGTTCTCAGCATCACGTTTCGAGCTAG
TTTTCTTAAAAAAACGTATATATATCGTGCTTCATCGTTTCAGCAATGTAATAAGCTGTGGGCTGCGTTAATTTCGACGTATCCCGCTTCAAATCTCATT
TTTAATGAGCTAAGACGTGCGTATCAGTAAATTATTCTACTACGTAATGCACATTAACACTTTTGCGTACTACCTATAGTTGAGTAGCGAAAGTATCGCC
GTCGGGTTCAAAATTCATATAGCATGCAATGCTAATTCGTTAATATACAGGTATTGTACGGCTCATCAGTATTGTTAGAGTGTGGGGAAACGCGTCAATG
GAATGCCAGTATGAACTACAATAAAACCTCTACTCCAATGCATGTCTAGGCATCTACTACCCCCAGAACCCATTATCTTACCGCTAAATACTATAAATTA
CAGATACATACCACACGTTTAAGCCAATGTAGCTATATGCCTTTATAGATGAGCACTCAGCACCGCTGCAGCTATAATATATCCGTCCCTAAAGTATTAC
ACAAAAGCTAACCTGAAACTTTTAATCAATCGTCTTCAGCTACTGTACCTCTCGCTACATGTACTCGCACTGCTATCGCTTATTACGCCGGTGCTATCGC
CTTCTATGCGCTTCTATCGCTTACTATACGCTGCTATCATTTACTATCATTTACTACATGTATGCCCTGCTATCGCGTTGCAATCGTTTTCTACGTGCTG
CTATCGCTAACTATACGTTCATATCGCTTACTACCTGCTGCTAGCGCTTAACTATGCGCTCCTATCGCTGACTACGCGCTGCTATAGCTAACTATGCGCT
GCTATGGCTTACAATGTGCTTATATTTTACCAAATTCGCTGAATTAAGAACTATACTATGTAGTAGGGCAAGCCCAGCTATCGCTGCCACTATGCACTTG
TAGTGTATCCCGGGTGAAAGACCAAAGTTGAACACCGGCGATACGGGGGCTGAACCCGCACGGAATAGTAGCCGAATGTATTGATCTAACCAAACAACCA
ATTGCGTAGTTGCTTAGCAAATTGTGAAGTGAGGTCGAGTGGCGGGTGCCGACTCTCTCTCAAATGCATATCTCTTGCTGGCGTGTCCAGCTGAGAGGCA
GTCAGCTTGAAGTGGCTTCAAGCTGAGAGACGGACTGAAGTGGTCAGTTCCCAGGAACTGCTCCGATCCACAACAGTCGAGCCCAAGAGAACATGTAGCC
TCGTACACTAATTCCTTATACCAGCTGGGTCAGGCACTGGCAGCCTGACCAGCGATATAACAGATAGCCGACGTCTGGCAGCGTTGGACATCTTGGTCAC
CTGTGATCTTCCTCTGGCGTGTACGACGAACACTCGTGGTGGAATCAAGCTTGCCACGCCTGCATCCACTACACAGCCTCCGAAGCTTGGATCCACCACT
ACCAAAACATAGCATGGCAGGCATGGTTGCGTGACCCAATCGCACAGATACCAAATGCCCGTCACCAGACTTGTCGGGCGGACTCCGCTCAGCTCCGCTA
CGTGCGAAGACGACTCGAGCGGCGAGTCAGCGTCTGCTTCTTGCCGACGTTGGTGAAGGCGTCGCGCCCTCCGAGATTGAGACTTGCCTGGCCGTCTGCG
ACCTGGTTCGTCCACGAGCTGCTTGGGGCTCACCATCCCCAACACTTACTTGTCTGCGACCTCGTCCACGCCGTGACCGAGAATTAGGCTGGGTGTCCGC
TAGCACGATTCCGCTTGCTGCAGCTTCAAGGCTGCCATCATCTGACGATTGCGGGACGTGCCACGAGGCCGACACCACCGCTTCTTGCCGGAAAGTCGAC
GTCCAGTCGATTGTCCAGTCTGTACAGGTACTTGAGTAGCCGGCGGCTCCTCGACGCTTGCCGCACCTTGGTCACCGCCGCCACTTGCACATAATCAGTA
GTTGCTCAGATCCTGGTCGCCTGCCGTGTCCACATACTTGCCCACCAATACCTTGATCTCCTTGGCGAGGTCCAGCATGGGATCGTAGGAGTCCTCGATG
GGCTGTAAGCCCTTCCAGCTGACGGGTAACTCGTAGTCACTGGTGGCTTCGTTCCAACGGTGATCCTTGAGACTACCCACAGCAAGCAGGATACCTTGAG
ATGCAACATGATCTAGCAGTTCCTCTGTCACTTCGAGGCTGTCATCCGCGTACATCTTCAAGCGTGAGGCATGAACGTCCTGTTCGTCACCTGTAACCAA
GTCCTGTACACGAAACGAGTGTGCATCAGCTCGCACCACTCTGTAGGGGCCAATCCAGGTCACCTGAAGCTTGTTCCCGTGCTTCTCGTCGACGCGAGAC
CTTAAAACAAAGTCACCCACTGCAAAATTCACGAGGTTTTCACCGCGCTGGCACTTCTTCTTCAGCAGGCGTTGCTTCTCCCTCTGGTCTTCGACGTCCT
TGTGCATGTCGTGTATGCTGCCACGCAGCTTCTCGAGGAACGCCTCGATCGCATCACTGTCAGGAACAGTTTGCAGCTCACCCGTCTCCGGCAGGTAGAA
CTCCTTGAGTGGTGTGGGGCACTGCAGGCCCGTGAACAGCTCCATCGGCGCACGGTTCCCCAGTGATGAGACAGCCGTGTGGTTGAGACTTGACTGGACC
ATGGGGACCATGTACACCCAATCCTTGTAGCTTATCTTGTACTCCAGGATCATCGCTCGCATGACATGCAGTATGTCTCGGTTGGCCCGTTCGACTGAGC
CATTTATCCAGGGACAGTAAGCTAGCGTGAACGATTGCTTGGATTTCAAGCGACGACACAACTCCGCAACCACTTCATTCTTGACGTGCGTGTCATTATC
TGATACCCATTCAGGCGGGATACCAAATCGAAAGTGCCAGTCCAGCAGGGCTTCAGTCACCACGCTGCTGTCGGCTGTGTCGGCCACAACCCGCTCGCAG
TAATGGGTCGCGTGATCCTTGTGAACAAACAGGTACTTGCTCTGGCCATAAGACTCGCCCATGTAGAGGAAGTCAAAGTGGAGGACTTCATTACGAGAGC
TGTACTCGATCGTCTCGCCCCACGGCCTGGGGATAATCTTCCCCCCTCGCGAATGCAGACACAGCAGACACTGGCCAACAAACGAAGAAACCACCGCAGA
GAGGTGCTCGATAGCAAACAGACGGCGCAAGTGTGCGACCATGGCGTGTTGCCCACGATGTCCTTGGGCGCCACAGTGTACCACGATGCACAGCCGCTGA
ATGAGCTCCTTGGCCTCGTAAGGTACCCAAATCTTGTCATCAATCATGAGTAGTCCGTCGGCGTTCCGTTCGGCGTCCACGGGCGCTTCAAACTCGGACT
GGGTGTCAAACAGCTCCACTAGAGTAGGCCAGACAAAATCCTCAGCATCAAGGGGGCGCAGAGGTGCCGGGCTTCGTGTCTCCGATGCCGCAGGCTCCGA
TTGACTGCGCACAGCTTTCAAACGCTTGACACGAACAGTAGGAGTGTGATTTCCAGCCCAGCGTGAGATCATATCCGCCCAGACATTGGACGGACCAGGA
ACGTGCTCCACTACGTAGCGGAAATTGACCAGCTTCGTCGACCAGCGCAGCAACTTGCCCTTGATGTGCTTTTTGACACTCTGATGCGGGGCAAACACAT
GGATCAGGTTCCTGTGATCGCAATACATGCGAAATGGCTTGGGCCTCAGCAACAAGTAGTCCAGTTTGTCACAGGCCGTGACGATCGGGAACGCCTCCTT
CTCGATCACGGTCCAGTTCAATTGGCTGCCACTGAAGGTGCCGCTCATGCAGTACAGGTGACGATGCTGCTGGTCCGTAGCAGGCACCCTTGGGTCAAAG
TTCACGACTTGAGTTACAATGAGCGAACAGCCGACGTCGGACGCGTCCGTGAATAAACACGTCGTGGCTGTGTCGACAGGAAAATCAAGAGTAGCCGCCG
TCGCTAACTTCTCCTTCATATTGTCGAATGCTTGGCGCTCCTCCACAGTCAGCTCCAGCTCAATACTAGCAGCGGCACGTCGAGTTCGCCTCGTGGTGGT
GAGCGCTGCGTCGAGGCGTTTCTGCAGGGGCGCTACCTGTCTGGCGAAGTCAACAATCGACTCCCTCATCCAGTTGATAGCACACACGAACTGCTGAAGT
TCACCAGCCGTCTCGGGGTACGGCATCGCTCGCAGCGTGTCGATACGGGTTGGATCATGCCGCACACCCTGGTGATTGATCAACCTGCCGCGCCACTTCA
CGTCAGACCGGTACCGGCTGCACTTCTTGGCGCTGAGCTTGAGCCTAAATTGGTTCAGCAGCGAAAACCCCTCGGCCAGCTTGTCCAGATAGCTGTCAAT
GTCGTCGGCGAAAAGCAACAAATCGTCGATCCAGATCAGGAGAGCAGGCTCGCGAAACAAGTCTCCATAGTTTTCTGGAAAAAGATGGTTGCGTCGCTGC
AGCTTTGTGGAACTCGCCTCGGTGTAAAAAATTTCTCGTCTGTCATGTAGGAGAGGAACTCCTGGCACATCTCAGCGAGGGGCAATTGCCAGAAGCCCTT
AAGAAAGTCAAAGAGTGCAAAGTGTTTTTTACCACGTGCATTCTCCAAGATTACCGAAAGTATCGGCATGACAGCGGCCATCACTTCAGTCTCAGCATTA
GCCAGTCGATAGTCCGTCGTTTGGCGCAAGTCCATGAGATCAGCTGACTTCTTGACGGGCAAGACGGGACTCGCCCAGCGACTTTGGGGGTTCTCATACA
CCATTCCTAGAGACACAAGACGAGCGTTAAACTCACGCAGAAAAGTGCGGATGTGCGGCGGGTACTTCCGGGGCTTACACTTCGTCGGGCGAGCCCCGTC
ACGGAGTCGT