Description :
From Genome Similarity Track
Location :
Scaffold_241:51470- 52992
Sequence
1522 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGACACGCATACACAAATTGCCCATATTATAGTACGGCAAAGGCATGTTGTCCACCGGAAA
GTCTCTGAACTTGCTGGTAAGCTGCTAACGCGGGTCCGATTTGTCCTGTTCGTTCTAAACACACCGCGAGCTGGAATTTCGCCTCAATTTCGCTCGGTTT
TGCAGTCGATAAACTCGTGTAAAACTTGATAGCTCGGTCATAATCTCCATTTGCTCGTGCCTGGAAAGCTCTCGAGCACAGACGTTCTGTAGCATTCATC
GCGGCTGTGGAGACGACACGAGCTCGGGACAATAACTCCATAGTTCTCGTTTCTACTCCATCACGATTGGGCTTACCATCCCGACCAAGTTGCCCTCGAG
ACTCCACACTTCGACCAATAAGCGGGTTCACATACTGTTCCTGGTTTCGTTCGCGTCGAATGGCCTCTTGTATCGCTATAGTGTCACTTCTCGTCGTAAA
ATGTTCCTCATGTTCATGATGACGGATTTGAGTCTTCGAGGTTCGACTGGTAGCAGGTCGTTTGGGTAGTTTGATGCCCTCCGATGGAGCAGATACTCGA
GCGGTAGAAGGCCTTAAAGGTCGTTGTTGATTGGTCTGCTGTGTGTTATTAATAGTCGAGGTCAGGAACGCCCATTGTGCGGTGGCTGGATAGGACAATT
CCTGTCGAAGTCTGCGATGTGAACTAGCCGAAGACCCACGGGCAGATCTCACAGTTCCATCGGGAGATGTCCTCGTTGATGGGGTACATCCTATAGATTC
CGATGCTAACGGAGGTCCTTGCATTTTCGCTTGCCACAGTACGTGCTCTTTTTTTCTTGATGAGCATTCACTATTTTTAAAAGGTCTTGACGTTTATAAA
TACCTGACAACACTGCACCGATCAACCAAATTGATGCTATGGCTTCTTCTATTCCAACAGTAGGCGACCAGAATGACGACTTGGAGAACGCAGTATTTCG
CGAGAAGCAAGGGATAGGAAGCGATGTTCCTTCACCAACTTTTTCGCGTTTATTATGCTGTCTACGAAGTCGCTGTCTTCGTGGAATCTGTGTGGGTTTT
CCGTGTGTGGTATTTTTACTACTATTTTTAAGTCTTCCCTCCAGTACGGCGACAAGTACCAGACGAGTTTTCTTGATCCTAGCTGCCGTCCCACTGATTA
TTTACATTGTCGTTGGCATATCCACTGTGGTACTCGCGTATTGCACTCAAGTTTCGCTCGAAACGCAAAATGCTCAGGCAGCTCATCAATACTTGAACAC
TAAAACTCAACAGAGTAAAATC