Description :
From Genome Similarity Track
Location :
Scaffold_76:51469- 59551
Sequence
8082 bases(100 bases per row)
CACTTTAGTGTTTGGTCCATGGAACACGACCGGATATCGTCAACGCGGTCAGAGAAGTGAGTAAATTTCTATCTTGCTACATCCGATCGCATTGGGATGC
AGCTTGGCGAGAACTCAAATGCTAGAAAGGGAGGTTAACGTACGGTTTGTTTCTCAATGAAAAAAGAAAGACGTGAAGTGCGAAGTGTACACTGATACGA
GCTTCGCGTGTCAGTCAAAACAATGCAAAATCATAACTGGGTAAGTGATTCAAATGACCGAAGCCACTATATTATAGTGCAGAAGCAAGCAGGAAGGCGT
GCCACTCTCGCCAACTTAAGCTGAACTCGTCGCACAAAGTGAGGGAGCTAAGGAAAGCGAGTGGTTGTGGCATTTGGCTGGGGAAATAGAATTTCCTTAA
AAGGCACCAGTGCAGGTATGGTGTGACAGCAACCCTGCCATCAGCATTGCGGAAACCCCGGGAATCACACAGCAAATAATTATATTAAAATCCGCATTCT
GTTTACGAGGGACCGTGTTGAACTCGGCCGCGTCAAGATAGCTCACTCCTCTACAACAGAGATGACAGCGGATGTCCTTACTAAAGTTCTACCCACGAAA
CAATTCCTAAAACTAAGAAAGAAGCTAGGCGTGCGCGATTTGAAGTTGTTTCCAAGCATTTAGTGGTAGTGTGGAATAGAGAGGCGCGCGGAGCGCTCCC
TACTTACGGAAAGACAGCTGGCAACGCTTGTCTGCCTGGCGCTAAATTTGGCAATGAAAGCAGTACCTTTTTACTATTTTAATTTCATATTAGTAAGAAA
GACAGAAAAAGGTTCAAATCGCCATTTGCGATCTGGATAGTACAGGCAGAGAGCTGCCTACCATCGATTGTGCGATGATAACAAGCGGTTGAGGAGCGAG
CGCGCTTAGGATGCAGTCCGAAGACGTGATCACTTCCTCTTTTGCATACAGGTACCCACCACGGATCCAGTGTAGTATGCATAAGACTAGAGGATAAAGA
GTAATATCATTGTAGTGAGTATCCTACACCGTGTGTTTATTTCAATACTTTCGCATTCTACAGTACCTGAGGCGTGTCCAGCTTCATCCCTTCAATTCCC
GGCTGAAAAAGGGTAGTATATAATACACATTAAACATATTATGTTTAACATGTTGGACCCACCAACATAATTAACATAGGCGTGTGTTTATTCCACTTCT
ACGTACGATACAGTTTGTTGGAGGGTTTTGGGAGGGGGTGCGTGTCAGTGTGTACATAATCCATCCACCTCCAACATATTGCCTTTATGTTAGCTGTTTT
GTGATAGGGCCGCTCGTGTTTGATGGAGGATCCAGCATAGCAGGTGGCCTTTTGAACTCATTTTTGTGCTAGCGTATCCGAGCACATGTAAGATAGCCAA
TCGTAAGGCAGCAGCATCATTTCGTTTTGAAGAATCATGGGTGGCTGTCCACCACTTAGCCTTGATCGCTCGTGCCTGTGCCGCCCAAAGCCCGTACCTT
CCTAAATTGCACCCCCATAAGTGACACTGCTGTCCACTTCCTGTCCTCAGCCATCTTCCATATCGACACGGCGGCAAGCACGCGAGCTATTCTTGCCGGC
GGCGACCCTGCACCCGCCACCCTTTCAGTACACACTCGGGAATGTTGCGCCCGCTGTCCCAGTCCTTGTGCTAGATGTGCCAGCAAGCATGACTTAGCGT
TGTCGGGACGCGCGACGTTCCAGAGATGTTTGCATAAAAGCACACTCTGAGCCAAACGTAAGGTGCTAAAGTAATAATCGTACGTATCTCAGATCATCCA
CATAGCGGCCAGGACAATAGTACATGGTAAACCTTGGTTTGACTTTGAAGACGGCGCACACCTAGCACGAGCGTGTTACACGCTTCCTGTCCGCCCTTGG
CGTCTGTGTAATCAGGGCATTGCTTAATAAAGTGGCCTCCTTGCTCGGCGGTTGCCTCTCGAGCCAGCGAGACCGTCGAAGAAGCTGCTGTCATATCTTC
TGCGCTTGTAACGCCCTGTATGTCACAATAAAACGTTAATTTTTTCTAGTATCAAGATAAATTAAAGGAAAGTATATAAATACCTCAGTATCCTTGAACA
GTCGTCATCGATCGCGAGTAGCTGCTCGTGTAGCGTCTCCATAAGTTTGTAGTGTTGTGGGGATTTCTGGTTCGGAATTTTTATGTAGTGGCGGTGGACT
AATTAGCTTCAACAGGAGCCGGCAGCTATCCCTCTACGAGCGCGAGTCTGATCTTGATCAACGGCGGGCGCGGCGGGGGTACCTCGTTAGCTCGGCGTAG
ATGTCGTTCATACCGACGCAAATTCTTGAGCTTACGCCTGGCCTCTGGCGCGAGTTTGTGCGCTAGGGCCTTGCCAGCAGGAGCAACCATCTTTGCCCTT
GCCTCAGAATTTCCAAGACGAAGGGGGAGACGCATAAATCACCTATCAACGCATAGTACCGTATTTATTGCTCTTCCTTTCCTGGAGGTTTCCCTACATC
TGTGCATTGACTTCTTTTAGACTTGGTCCGCTTGAATATTACTCAAGTCCAGTATGCTCCAAAATCAAATACTTCATTTAATAGTGGGTCCAACATGCGT
ATAGCCGCGGGTCATACATTCTCCGGAGTATACTCTGATTATGTTGGTGGGTCCAACACGGTGGGCTCTATCCTGGAGATTTAAAAAAACCTCTACACGC
GAAGCAACTAGCGAAGCTATGCTGTACGTTAACAGCCCGTCTTCAATCCGATACCTATCGATCTGATGGCGTGTGGAGCGCGACAAAGCACTCAGTGTCT
TTTCACTGGGCGAGCGGAGATGCTCCAGAATACTCGAATAGACCGGATCGAATTCATACGCAGTCCGGATTTCGTCGCGGAGTGGGGTTTCTGGAGACAA
GCTCGTCAGGTTCAATCCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCATACCTAGTGAGCTCATACAAAACCTGAATGGTACCAGACTGGCTTTTTTAGCT
CGGAGCTTGCGTTTTCGTCGGTCCCTACTGCTTCAGAGAGCCTGGTAAGGCTTTATCGCCTTATGCGTAAGAGATAGTGCCGCGTGATGCATATCCTGCC
TCCAGTAGGATCTGTAGCAACTGATCGGTATCGTGTAGAGCAGCGCCCATTGCGGCTGGCAGCCTCCGAATAGAAACATGTTGCTAGATCAATCAGATCG
GTCAATTCTAGGCGAAGACAAACCTAAGACATGCCTGCAGGTGGCTGGGTCGTAGATACAAGGAGCAAGTCTTGCTCGCTCGCCTACAACAGGAAGCGTG
TTATGTGCTGCCATGTAATCAGTGCCTGTGTGCAAGGAGACCTGTCGTGCTGCGCAGTAAGCATGCGGCTCAGACAGTTTGTCCGACCAAGCCATGCCCA
TGCTCAGACTCTAGAAGGATCACCTGACTCTGATACTGACTTTTTGTCTCAAGCCTATGACACTTCTACGTCAAGACCGACCGGATATATAAGAGTGGAC
GACAGAAATCAAGATTCTTCTTCTAATTCAGACCATGTAATAGAAAGATCGGTGCGAGCAGAGCCACCGAGTGCGCTTACAGCCGTCGACCATACTGTAG
AGGATGAAGATGACGCGCAAGGATTTGAGCCAGCCACCTCTACGCATGGTCCAGCGCCTTTCATTGCGAGCTCTGCTGCGACGGATATACTGGACTATAG
CCTCGAGGACGAACACGTCCCGACTGAGACACCTACTGAGCATCAAGGCCAATCGAATGGCGTATCCAGGAGTTGTCGGCGCTCCAAACGTCAGCGGAAG
CTTACATGACGAGCTGTCGAGACTCGCCTCCAAAGCAAAAACAATCGAGGCAATGACGTAGGTGCGAGATCTCTTTTATCATTTGTATCCCAAGTTTCTT
AGCCTTAAATATTACTAATTTCATTTCTTACTTCACCACCTACAGGTCCGGCTTGCGTCCGCTCGCACGGATGAAGGATTTAACTAAAGGAGGCAAGGAT
GAGACTGCTGTGGTCTAGAACACACCTGAAGTACTGAGCGGACATGCCCTGGAAGAGCTAACCTAAGAAGAGATATACCGCACAGCTCTCGACTCGACGT
GGACAACCGCTATGGTCCTCTGGGGGTCAGCGGGAAATATTTTCATGCACTCCTCATATGTCGAGACTTTATCGAGACACTTTTTCAGACAATTCAGTCG
TATCGAACGAGCTTCCTTCTTCCTAGTATATAGCTGAATCGATTTTACCAACTGCAGAGGTCGGAAAAAATAAATGCGATTCAATAAATTATAGGGTTTT
GCAAATCAAATTTACATTATTGGTAGCCGACCTTGACAATACAAAACGATATTAGACCTATTATTGACAATAAAAATGGCAAAAGGTTCTCCGTCTCGCC
AATCAGATCCGATGACATCATTTTCGTGGTCATAATGTTCAGATTTGCGGCAATGCCACGTAAAAGTAAACGAAACACAAATCCACGCACTTGCTAGCGC
CAAACGGCAGTAGAAGATGCAAAAAAACGAGTCTACCTGACACCTGCAGCAAAGTTTTAAGGTACTGGAGAAGGAAGCAGCTGATTGCCCTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN