Description :
From Genome Similarity Track
Location :
scaffold_42:514601- 520407
Transcript NameFunction/comments
g11344.t1 conserved hypothetical protein
g11345.t1 hypothetical protein PHYSODRAFT_471496
g11346.t1 hypothetical protein PHYSODRAFT_471496
g11347.t1 hypothetical protein PHYSODRAFT_471496

Sequence
5806 bases(100 bases per row)
TCGGCCGGCTCGCCCCCGTACAGCCGCGGCAATCGCAATGACGAGATGGACGTTATGGCCCAATTGGCCTCGCAGTACTACGCGTCCAGCCGCAATCGCT
CGTTCTCGGCGCCCATCCAGCCGTCGGCTCTGGGCTCGGCCTGGAATTCCTTCGCAGATGACACGTCCGTGTCAGCCGCGGCCGCTGTGGCCGCCACGCA
GCGCCACCATCAGATGCAGATGCAGATGCAGAATCAGAACTTGCGGCCGCATCAGCCACCGCTTCCGCAGGGTCCGCCGCCTCCGGTGCTCAACATTATG
GTGCCGCCACCTCCGCCTAGTGACGAGGTCGCTGTCGGAGCTATTGGCCAGGCCGTGCAGTCGTTGAGCCTGTCGAGCGAGACGGAGACCAGCGACGCAG
GACTTCACGTGGACACTACAGGGGACGCCATGGGCGCTCCGTTGCCGGCCACATTCCTCCGCACGATCTGCGACCAATTGGAGTACTACTTCTGCGACGA
GAACTTGCTGGGAGACCTCTTTCTGTTGAAGAACATGAACATGGACGGATACGTCAAGTTGGACCTGCTGGCGTCGTTCGGCCGCGTGAAAAAGCTGTCG
ACCGATATGGACCAGATCAAGAAAGCGCTGGAGCTTTCGACCAAGCTGCTGCTAAATGAGGACGAGTCCATGGTCTGTCGCAAGGAGCCGCTGGCGCCCA
ACCAGACCTACCACGGCAAATTGGCCCGCACGGCCATTGCGTACAACTTGCCGGAAGACGCGTCGGTCGCGTCGCTGCGCGAGACGTTCCAGGGCTGCGG
CGAGATCTCGTACTTACGCCTGTTGAAGAAGAACACGACCACGGGTCGCAATGCCGTGCTGAAGCCCCCCATCGCGGCGGGCGAGACGTACGCTATCATC
GAGTTCGTGGACGACGAGATGACCAAGCACGCCGTGTTGACACTGTCGGACCAGTATAATTGGCGCACAGGGATGCAGGTGGTGCTCTTTGATGGCACGA
ACTGCGACAAGCTCAAGCAGAAGATGTTCCCTGTGGAGCTCGGCGGTGATCGCCGTCGTGCGAAGTCGGCGTCCGCTCTCACGCGCCCCGTGCACGTGGA
ATCGGTCGGCGAAGGGCTGGACGACCTCCGTGAAGGTAAGGTGAACACGGGTACGGTGTACTCGATCCGAGGCGCGGGTGGACTCATTACGCCGACGCGA
CAGGATTCAGCCTGTATCTCGTTCCGCCTTATCCCGGATGAAGATGGCAACATAGACATCAGGCAGGGCGACTACGTGTCGTTCACAGTGGGGAAGAACA
AGAAGAGCGGCCGCAAGTACGCCAGCAAGGTCAAGCTGGAATTCCGCCCGCCGTCGAATCTGACAGGCGATGCCAACAACAACGCCGGTGGCCTGAGCGG
CCTGGCAGCGCTGAGTGGAGGCTCATCAAGTGGAAATGGGCAGAAGGACTACTTCGCTCCGTCGCCGAGTCGATGGGAGTCGCGTAGTCGCGCAGCAACG
GTGGGCGCTCCACCCCAGCCGGGCGCCTTCCGTACTCGTTCGTCGTCGTCGGGCACGCGGCCGAAGTTGAACTTGTCGTCGCCACGGATGGCGCAGTCAC
CTGTACACAACAACAACACCAGTAACCTCGGGGGTAACGCGTTGGCGCCTCCTCCTGGAATGGGACTCAACGGCAGCAACCAGCTGTACCGCCAGGCCAT
TGGGCCGGACGGCACGCGGGGCTTTGGCTTCCGTCGTACCGGTGGTGAGGCACCGGAGATCGCACCGGAACTCAAGTTCCCGGTGATGGAGCGTCGGAGA
TCGCGCTCGTCGGGCGGTGCCTGGTAGACGGATGATGGAGGGCACTGACGAAGAGAGAGCACCACCCAAGGCTACTCTCATGTCGAAACACACGCTGGTA
CGAGCGTGATATGCTGGAAAATGACGAAGAATGACGAGAAACACTGAGAATTAGGCGCTAGCAAGACAGAAACGAAGATGCGATTCGACGCGAGACAAAA
AATCAAAAAGAGCACACGAAATGCACAGTTGATAGGAAGATAAGGAGGGCAGACACCAGGAAGCACGAACGAAAATGTATTGAGTGTGAGAACCCCCTTC
AAAGTACCCAGTCTCCCGATCTACGTGGCCTACGCGTTGGCAACGTCTACGGGGCCGTGGATCTTGAAGTCGCCGATCTGGTTCTCCTTGCCATCGTCGG
CGTAGTTGCCCTGGACGCGCTTCAAAAGAAACTCGCGCCAACTAAATGGACGGTAGTTGGCCAGCTCTCCTTCCTTCACCACGATGGGCTCCACCTGGAC
ATCATACGCCGGCAAATAGAAGAACGGAGCCGAGAATCGGCCAGCCTTGTTGCTTGCCAGCACGCGGTGCAGTGGGGCCATGAACTTGTCGTTCGACCAC
ACTTGCACCATGTCACCAATGTTAATGGTGTACGTACCCTTCCGCGGCGGCACATTGACCCAGGTTTGAGATTCCCGGTGAAGTACCTGCAGCGATGCGA
CGTCATCGTCCTGGAGCAGCACAGTAAGTGCACCGAAATCAGTGTGGTGGTAGACGCCCATGGTCTTCTCTGGTTCAGGAGCCACAGGGTAGTGATTCAA
CCGTAGCAAACTCGAGTGGTTTCCTTCGTAAAACTTGTCGAAGAATGCAGGCTCCTCGCCCAACGCCACGGCGAACACCTTCAGCAAGCGGCGAGCAATG
AGCTCCACCTTCTTGTAGTACGCTTGCATCTCGTGGCGGAACCCAGGTAGCGCTGCCTCATCGAGCCACTGGTTTTGGTCTTCACCCAGCCGCTCGATCT
TGTCCGTTGGGGGACCATCTTCATGGGCACCAGCAAAGTCAAAGCACTCCTTCCAGTCCGTCTTGTTCTTGGTGAGCTCGTCCACGACATAGCCACGGTT
GTTGTTGGGAGTACGGAGAATGGAGCGCTTGGTCTCGACAGGCAGGCGGAAGAAAGAGCGCATGGACTCTTGGAACTCGTCGATTTCTTGTTGCGGCAGA
CCGTGGTTGGCGATGTAGAAGAACCCCCACTCACTCGCAGCAGCGCGGATCTCTTCAACTAGGTGGCCAAGCGCAGCACTCTTGGCTTCACGCAGTGCAG
CGTCGACCTCGACGTCGGTGGGGAACGCCGTGAGCGCTCCAATGTTGACGACAGGTACTTGATGAACGTCCATCTTGGCCTTGAGCTTGCAAATCTCGGA
ATGAACGTTGGTCTGCCTATTAACGTGCCACGGGAGGGTAGCGTTGAGGCTCTAGCGAGGGCCTTACGCTTCTTGCATGACAAGCTCTGAAGTCTTGACG
CTGCTTTCATAGGAAAAGTGATTGGCCGGTTCAAGATACCCTCGAAGTGCTGCCAGTAACACGCTTACGTTATCGAATTGTATACGATTCGACCAGCTGC
CCTGCATGGCGCCTGCTGCTTTCTTTTTTAACTTTATCCACACGATGAACTTCTTCTCGACGATTCTTTTTGTTAACTCCTTGGTCATGTTATCATGATG
CCTTTCTTGAAAACTTCACTCGTCGTCTACGAGTTAGCAACGTCGATGGGGCCGTGGATCTTGAAGTCGCCGATCTGGTTCTCCTTGCCAACGTCGGCGT
AGTTGCCTTGGTAGCGCGTCAACAGGAACTCGCGCCAACTAAACGGACGGTAGTTGGCCACTTCTCCTTCCTTCACCACGATGGGCTCCACCTGGACATC
GTACGACGGGAAATAGAAGAACGGGGCCGAGAATCGGCCAGCCTTGTTGCTTGCCAGCACGCGGTGCAGTGGGGCCATGAACTTGTCGTTCGACCACACT
TGCACCATGTCACCAATGTTAATGGTGTACGTACCCTTCCGCGGCGGCACATTGACCCAGGTTTGAGATTCCCGGTGAAGTACCTGCAGCGATGCGACGT
CATCGTCCTGGAGCAGAACAGTAAGTGCACCGAAATCAGTGTGGTGGTAGACGCCCATGGTCTTCTCTGGTTCAGGAGCCACAGGGTAGTGATTCAACCG
TAGCAAACTCGAGTGGTTTCCTTCGTAAAACTTGTCGAAGAATGCAGGCTCCTCGCCCAACGCCACGGCGAACACCTTCAGCAAGCGGCGAGCAATGAGC
TCCACCTTCTTGTAGTACGCTTGCATCTCGTGGCGGAACCCAGGTAGCGCTGCCTCATCGAGCCACTGGTTTTGGTCTTCACCCAGCCGCTCGATCTTGT
CCGTTGGGGGACCATCTTCATGGGCACCAGCAAAGTCAAAGCACTCCTTCCAGTCCGTCTTGTTCTTGGTGAGCTCGTCCACGACATAGCCACGGTTGTT
GTTGGGAGTACGGAGAATGGAGCGCTTGGTCTCGACAGGCAGGCGGAAGAAAGAGCGCATGGACTCTTGGAACTCGTCGATTTCTTGTTGCGGCAGACCG
TGGTTGGCGATGTAGAAGAACCCCCACTCACTCGCAGCAGCGCGGATCTCTTCAACTAGGTGGCCAAGCGCAGCACTCTTGGCTTCACGCAGTGCAGCGT
CGACCTCGACGTCGGTGGGGAACGCCGTGAGCGCTCCAATGTTGACGACAGGTACTTGATGAACGTCCATCTTGGCCTTGAGCTTGCAAATCTCGGAATG
AACGTTGGTCTGCCTATTAACGTGCCACGGGAGGGTGGCGTTGAGGCTCTAGCGAGGGCCTTACGCTTCTTGCATGACAAGCTCTGAAGTCTTGACGCTG
CTTTCATAGGAAAAGTGATTGGCCGGTTCAAGATACCCTCGAAGTGCTGCCAGTAACACGCTTACGTTATCGAATTGTATACGATTCGTCCAGCTGCCCT
GCATGGCGCCTGCTGCTTTCTTTTTTAACTTTATCCACACGATGAACTTCTTCTCGACGATTCTTTTTGTTAACTCCTTGGTCATGTTATCATGATGCCT
TTCTTGAAAACTTCACTCGTCGTCTACGAGTTAGCAACGTCGATAGTGCCGTGGATCTTGTAGTCGCCGATCTGGTTCTCCTTGCCAAAGTCGGCGTAGT
TGCCTTTATAGCGCTGTCCACGGAACTCGCGCCAACTTATCGGGCGATAGTTGGCCACTTCACCGGCCTTCACCACAATAGGCTCCACCTGGACATTGTA
CGACGGGCCATAGAAGAATGGGACCGAGAACCGACCAGCCTTGTTGCTCGCCAGCACGCGGTGCAGTGGAGCCATGAACTTGTCGTTCGACCACACCTGC
ACCATATCACCAATGTTGATAGTGTAAGTGCCTTTACGCGGTGGGACGTTCACCCACGTCTGAGACTCTCGGTGGAGCACTTGCAATGACGCGACTTGGT
CGTCTTGCAGCAGAATTGTGAGCCCGCCAGAGTCCGTGTGGTGGTAGACGCCCATAGTCTTGTCCGGCTCGGGGGCCACAGGGTAGTAGTTCAGCCTCAT
CATACTCGTGTGAGTTTCGCCGAAGAACTGGTCGAAGAACGCAGGCTCTTCGCCTAGTGCCACTGCAAACACCTTCAGCAACCGACGAGCAATGAACTCC
ATCTTGCTGTAGTACGTCCTCATCTCGGTTCGGAAGCCAGGCAGAATCGACTCGTCGAGCCACTGGTTCTGGTCGCCGCCTAAGCGTTCGTTCGTGTCGT
TAGGTAGGCCATCTTCGTGAGGACCAGCGACGTCGAAGCACTGCTTCCAGTCCGTCTTGTTCTTGGTGAGCTCGCCCTCGACGAAGCCGCGATTGTTGGT
AGCGGTGCGGCGGATGGTGCGTTTGACCTCTGCTGGCAGGTGAAAGAAGGACCTCACGAACGCTTGGAACTCGTCAATCTCTTGCTGAGGCAGGCCGTGG
TTGGCG