Description :
From Genome Similarity Track
Location :
Scaffold_110:5145- 6349
Sequence
1204 bases(100 bases per row)
AACAAATCAATACATGATACCAGTATAAGCGGATCTAGTATCTCAATGATCATGAACAGGCTTTGAGAACGATTTTCGACATGCACAGACTACAAATACT
TGCGATAGCACAGCTCGTAAGCCTATATACGAAAGAATCATCAAAATAAAGATTAATATTCTACAGCACATTCAAAGCAGCGAAATGATAGAGGCACAGT
TAGAGAGAGTACCTCTAATCATTATGTCCAGCTTAGGTTGTATCGCTGTCAGCTATAAAAAGCGTGTGTGGATAGTGTTACTTCCCTAATATTTACCATG
CGCGAAATCAGGTCAATAAGGTCGCGATATTTTTTGTAACATATGCATGTCAAAATAACAATCGTCTAGAATCTTTCGCTGAGAATTAGCCAAACTTTTA
CTGAGACCAAAGTAACTTTGGTTAATCAATAAAGATGCCGATATGGCGTAAGATATAGTACAGATTTCCCTTTAGTAATATATTATCATTGTTAAACTTA
CTTTTAGTCTGCAACGATCCTCTATTCAGCGCATAAATCGCATTCACTCGTCTTGGGTGGTCGGCTCGACGCAACCTTGATTTCAGCCTGATGACATGCA
CAACTGTAAGATTATAAGTTATTGATCGAATCTATGGGTTTAACACATTTGACCAGCTCGGACACTATTCTGGTTGCCAATTTTCGCTATGGGACCTTTT
GTAAAGGATATAACCAGTATGACACATACTGCACAAGCATACGAGTTTCTCTTTTACCGATTGCTGTGCGGAACGAATACGAGCGATGAGGGATGGCGCA
ATAGTGCTTGATTCTTAAGTATTGAAGCGGAAGGAGCATTATTAATGTGCTTTGTCGTGGGTAAACGTTTTCACAGAGCAAAGCCGATACCAACTCACGC
AGCTTACCTATAGGGGTACCGTTAAACTGGTCGCTTCGATTACGGTACACTCTCTGTTTCGTAGACTGTCCATGTAACTGAAAGCGACCTTAAGTAATCT
ATGTACCAGTGTACAAAATGAGATGATTAACGCAAATACCACCACTGACGTGCTTTTAGTAATACTGTACACAAGAATACGGATCTAGACACCACCTGCT
TTATTTCTGAAACAGTTTTCAGAACGAGATTTGCAGATATTTAGCCAACCTGGTCAGCAGTATGTGTTCCATGCGCTAGAATTCGTTTTTATATCCAAAA
TTGG