Description :
From Genome Similarity Track
Location :
Scaffold_1860:5144- 6468
Transcript NameFunction/comments
Phyta_totarag13771hypothetical protein

Sequence
1324 bases(100 bases per row)
TATCCTCGTCGTTGCCACTACCGGGCACTGCCACTTTTGGCAGTCGCTCCGGCGGCAGGGGCAAGGTCGCGGTCGGTGTCCTGCACTGCAGCCAACCCAT
GGCAGGCCCCTGTGGCTCCTCAATTTCCTGGTGatcttcgtcgacatcaGCAGTTACCTGTTAGGCCAGGTTCTGCCATTCAAAATACCTGCGTGGTCCC
ACCGAGACATATCCAGGTAAGCGTGGCACTCGATCTCGGACCAGCCACATTCCGACGCGCATGTTGCGATCCAGCGCCAACTGGCGATCGCTCACGTTTG
tcagctgcaggaagagtGTTTTGCCAGGGCCGACTGTCAGAGTAGGCACCCAGCGAACCCCGGGGTTACCCACAGCTTCCGACTCTCGGCGCGTAGCTTC
ACCTCCGTTGATCCTCCAACGTCAACGTATCGTTCTTCGCTCAAGGTCACGTGTTCCACTCGCTCTCCGTAAAGTAGTCGCCTGCCGGATGGATGGCCAC
GGACTTCATCGGGGAGACAGATCGTGCTGTCGACATTATCAAGGCGGATACCAGCAGGAATCATGAAGTCCATACCGAGGATCAAGTCTTGAGGACCTAC
CCATACGTCGAAGAAGTAGATCAACGACCCAGCAAGCGTGATCTTGGGTCTGGTACGCCCGTCTGCCGTGTACGGGGATTTGCCAACACATTCACATTCA
GGTGTCTGACTTTCATCAAAACCTTACGAGCAAAGGCGGTGTCAATAATAGACACCTCGGCACCACTGTTAAACAACATGGTTCCTTTTGTCGCTGATCT
TCCCCACAGCATTCGCTtgcttgaacttcttgtcaGACACGTGGTACTTCCAGTATCCACGCGATTCTCCTGGCGAAATGTCCAAGGCCATCGTCACACT
TGATCTCGAGTACTCATCAATCTTGTGCCAACTTGACACAGCAGCCGTAGGTGTTCCATGAAGATCACATGTATTGTCGATCGGATTCGTCAGCTTGCTA
ACTATCGACTCCGATTGTTTCTCGACATATGCATAGACGCAGTATCTAGAGCGCTCCTCTCGTACCGGGTTCCAAACCGGCGAGCGCCCTAGTGTAACAT
AATTTCCGCCGTCTCTGTCAGCATGCCTGCGGGCTTGGTGGGGTTGAACCACCGACGGATCAAGTTGTAAAACTCTTCCATCGGGCATTGACCAGTGTCG
GGGAGCTCACCGCAGGCCTTACACACAACGAAACATCGGTCGGATGGATGCCCCTATCGGCCACACTTCTCGCAGATCAAGCGTCCCCAGCATCCAAGAT
CGGTATGCTTGCGCGACCCGCAGT