Description :
From Genome Similarity Track
Location :
contig_84:5143- 6606
Transcript NameFunction/comments
g10421.t1pol protein

Sequence
1463 bases(100 bases per row)
CCACGTGTCAGTGGTGTTGGGTACACCATGTACCCAACCCGGAAGAGTGACGGGCACTCTTCAGGTAACCCCGTTACACCAACGGTGAAAATCCTGGGCA
AAGCGCTCCAAGAACTCAAGAATCTCGGAGGCGCAGCAGAGACGTACCTCCACATTGACAGTGTGGATAAAACAATCCAGAAGGCCCTCAGTGCAAAACC
AGAGACAACAAAGAGCGACAGTCCCATCCAGGAACTGGGCCACAAGCTACGGCGTTTCTTTGGTGTGCAATGGAGCACACCAGCAAAAGCAGTTCGGACA
CTGACGAAAACACACCCGACTCGACAATTCAACTTTCAAAACCCCAGATACAATGCTGGAATACCTTCTATAGGAATAACATAAATATCAAATAGAAGGC
CACTTAACTCGGCACATGTACCCTGAACCATCGGCCCCGACGAGACACCGTGTTACACGTCGTCTTGAGACCTCCATTGGAAATCTAGGCGGTGAGGAAG
ATGCGAGTGACGCCTCCTTGGCTCAGTATTCGTCGGAGTTATGGAAGCAAGAGGGCCACCAAGTCCTCTCGCAGCGGTGGAGAACAGGTGCACAGGAGGG
CCACCAAGTCCTCTGTGCTTTGGTGCTTGAACGGAAACGCGACGGGTTCACCAGGTGTCATGCCCGCGTCTGGCTGCTTAGAAACCAGGCCAGAGCGCAT
GGCGCGAAGGCTCTGCCATGCTTGCTAAGCAGCCAGAAGCACTTGTGTGACGGCTGTCTTGACGGGCCAGCAGTCACAGTGACCATGCATATAGTAACAG
TGACCATGCATATAGTAACAGTGACCATGCTATAGTAACAGCGAACATGCATTTAGGTAGATGAACAAGAAGTGCCACAGAAAAAGAGAAACACATGCAG
GGTAGCAGCAAAGGCACGAAAGAATCAAGCAAAAAGAAGCTAGGACGCCCCTGTAGCACAGGAGGGCTTGCATGTTTAGGAGGACCAACGCAATTCATTA
TCAAATACACACACCAACCCGCATTTCGACTAAACGACCATGGCTCTAAGCAATAGCAACTTCAACGACAAACACTCTGTTGACGTGGAGCGCCGTTAGG
ATGCGCGAAGGACGACGACAGGACTCATGCAGTGATGACCTGCGTCGGATAGGACGACCAAGGCACGAGCGGCACGTTCCTGGCATGGTGTGTTTGGCTG
ATATATCCTGACTTGGGTTAAGTATGAGGAACTTGTCGAGATCTTATACGCATAAGATCCCGACAAGATACAGCATACTGGAATCCAGTCAAGATGGCTA
GGAGGTAATCAGGACGATGAGATGCAGCAAGGAAGCCCAGGGAGAGCAGTAGAAAAGGAGGACAGCGTGTAGATTGTAGAGCTAGCAATCAATCTCACTT
CGGCATTTGCCCTCTCCAAACCAACACACTCTTCTCCAGCTAAAACTCGACACCAGGCCCCAA