Description :
From Genome Similarity Track
Location :
Scaffold_41:5143- 6156
Transcript NameFunction/comments

Sequence
1013 bases(100 bases per row)
CTTACTCCTCAATTTCCGGTTTTCAGCGGAGCTCGCTCCCCCCTCATCGAACATGCCAAGGAGTCCACACTCTGCTGTCTCCCGCGGTCGTGTTCCCGAG
GCTCATCGTGCTGGTGAGGATTGGATGTTTGTTGCCAAGCACAACGGCATTTCTCCAACGACGGCCCGTCGGATCGTTGCCAGTGACCGTGAAGAGCCAT
CGCGTCGTGGAGGCGCACGCAGCGCTTGCATCAAGTGCACCCCGGAGATAGTGGCAGCTCTCGAAGGGTACCTTAACGACGATTGCACGTACACATGAAG
GACATGATTCTGTTCGACTTCGGTGTGAACATCAGCACATCGACCATATCGGATAGACTCCTGGGGATGCTGTACACGCTGAAGCAGGTAAGATGCTGTA
AGTCGCCATGCACTCCAGTTAACACCTCATGTTCTAATGGCTTATATTATTTGCGATCTAGGTCCGTGTGGAGCCTCAGACGTGTCAACAAGACCAAGCG
CAAGCAGTTTGCTGTGGACCTTTGCAAGCATATGGATGCTGGCGATTTCGTTGTTTACTACGATGAGACGAATTTTAACGTCTATTGCAAGCGCAGCCAA
GGCCGCGCGCGAAAGGGCGAACGAGCGACGGTTGTGCTACCTCCTTCCAAGGGCGCCAATCTCCAGATTCAGTGCGCCGTCTCGACGGAGGTTGGGTTGG
TTCACCACCGCCTAGAACGTGGCAGCATCCGTATGGATGTCAACGCGTCATTCGTTGACGAGATTTACGAAAACGTCAAGGCCTCGCCAACGTTTCAGGA
GCATTTCGAGGGCAAGAAGATCGTGGTTGTGCTGGATAACGCGCCGGCACACAGCCAAACGGAAGAACGGGTCGTCGAGCACGATGACCTCGTTCTTCTC
CGCTTAGCGCCATACTCCCCGACGTGCAACCCGATTGAGGGTTGCTTCAGCGTCCTGAAGGTTCGAATCAAGGCGAACCTGGCGTTGCCGCGAGAGGAAC
TGGTGGCAAGTCG