Description :
From Genome Similarity Track
Location :
contig_120:51427- 52879
Transcript NameFunction/comments
g13414.t1hypothetical protein

Sequence
1452 bases(100 bases per row)
CTGGCGCGCGAGCTCTTGCAATGTTGCCACATCGGTAGGCGTGAGACTCTGCAGAATAAATTTGACTCCACTACTCGTGGGATCTGCCGTCTTCGCACGC
TTAGCTAGCCGCAACTCAATTTCATCCGTGTATGGTTCGCAGGTATCAAGGTTCTGACTGAGCCATTCAAACCGCAGCGAGTCTTCCTCCTTCCAAATGG
AGGGGCCGTTGACGTGATCCATTGAAGCCACAAGAGCGATGAAAGGCGACTTCGCAAGCCAGCTCAGACACGTCTGAGCCTCTGGGTTACGTAGCGCCAG
ACCGTCAATCGAATGCACCAGCAGGTACACTTGAGGCGCATGCCTTGCCATTGACTTGGTTCTAGCAATGTCACGACACTAAATAAAACATGATAAATGC
TGCAACTTCTACAATTCCAATAAAGAGGGGGGAGGTTGGTTACCTGTTGGGAAAGTGATTGGTTTGGCTTCACGTCGATGCTCAATATCTGTACAACAAG
ATAAGGAGACGTAAGTTCGCGTTAACCTCTCCAACTCCAGCTATGCTATTACTGATTCACCTTCTGCTGGATGGTCTCAGCCAGATACTTAAGCGAGACA
ACAGGCAGATAACCATGCACCTGCATCACAACACCGTCGCTCAAATGCGTCGACGCGAACTCCTGCAGATAACTAAAGTGAGTCTTCTGTGCATGCCCCA
GCAAGACACACACCGCTCACTTGAAGCAGCGACAGCTTGGAGCCCACGCCGTAGAAGAGCAGGTTGTAGCCGGCCAGCAGCTCGCTCTTCCACGTCGGGA
AGTGCTGCGTGAAACCTCCAAGCGCTGTCTCCACGTGCTCGTCCGCAGCTCGCAGCTCCGCCAGCAGCTGCCCGCGTGACGGCAAGTGTAGCGCCCCCTC
GTCATGGTGGTCTTCGTCCTCCTGTTCCTGGTGACGCCGCGCCCGTTGCTCCTTCAGAGGCAGCGGCTTGGGCTTGCGAGGCACACGCTGGCGGAGGCGC
TTGGATGTGAAGTACGCGTTGGCTGAGGACGCGCCAAGCTCGACGCTGTCGCTGGGCGCCGTGCGCCTCTGCCGGAACCGCGCGCGCAGCCCGTCGCTCA
TGGCTGGCACAAAACCCAAATATTCCGTACGATAGGATTCGACACGGCATTTTTCATTTTCGCATAATAATGCCTCCTCGTTGTCTCCGCGGAGGACGGC
GCTTGCGCGACGCTGGAGCTTGGAGACTGGACGAGTGCGCTTGACGGAGGAGTTTCTGGCGACGGAGCTCCGGCAAACGGCCGACGTGCTCAAACAAGTC
GGCGTGCTCGGCTGGAAGATCGCTGGCCTGCACATTCTGCGTTGCCTGAAGGAGAGCACCTCGGTGCCAACTTCTTCTATCGGTGCTGCAGTGCATCGCT
CGCGCAGACGGAAAAACGAGGCAAGGAAACACCAAAACACCCGGATCTTCAC