Description :
From Genome Similarity Track
Location :
scaffold_122:5142- 7861
Sequence
2719 bases(100 bases per row)
TATGACTTCAGCCTACCTACATAAAATGTATGATGTTGGTGCATGCGTGTTAAAATGGTCAATGTATACGCGTCACCAAAAACCTTGAACAATCTATTCA
ATCTTTGCAAAACGTTTTCTGCTTCTCAAGATGGACACTGCATGTTCAGGCAGATTTGTCGTGCTAAGCTGTACAGGGACATTGACCTTACATACCTTTT
CGCTCTTCCTTTCACTCTCATCTGCTTATTCTTTGTGCAGACCCTGGGCTATCGCAATTGCGTCTCGAACAAACCGCACAACGGCTTGTCTCTTCGTAAT
AAAGACATCGACGTGCTGGTCCCCacgacttgtcatgtcgtctagATGATTTGTTGTGTCAAATTCGCTTTTAGCTATGTGACAGTATTTAGGTCTGACT
GTGGCTCTAGAGCCATAGTTTTTACTCTAACTAAGGTAGAGACTTGGCCCATTATGTTAGCAAATACTCTAGGATGAATTCCATAGCTTACACATAATGG
CGAATGAACTATCGAGACATGTGTGTTCAACgcaaactcttcaagagGGAAAAATTTACTTCACTCTTTGAATGACGTCACAAAACTACGTTGTACGTTT
TCCAGGACTCGATCCACACGCTCTGTTTGACCATCCGACTAAGGGTGTGCTGTTATTGACATGGATAATTCGGTGCCCAAGAGCCCAAATAGTGCACTCC
AAAACTTCGAGGCAAGACGGGTATCACGGTCAGATACGATATCAACAGACAGGTCATGCAATGTCTACAAATTCCCTAGAAGTCGTATCCAAAACAGACG
CAAGacaaaccatcttgctgaatcgGTCCAATATCACAAGGATGCCACTGCGTTCATGTGTGTCGCGCGGAAGttccaaaaaaaatttgatatTCACCGA
CTTCCACCTGTCAGTACTGCCACTGATCGAAGTAGGGCCAGAGTGGAATTCAATGCTTCCCTCTCTAGCAAATCTCACAGGTCCTCGCATACTTGCGCCT
CCACCTATTCATGTGTAGTCAATAGTAATCCCGGGAATACCGAAAAACGTTTTCACACGTCCGAGATAGCCACCCGAACGGCTGTCATGGTAGACGATGA
CGAGGTCTTCGTCATTTGGAGCAACAACTCTTACTGCACCCCCGTGTTTAACCGCATAGAGCAACAATCCGTCGTGTACTCCAAAAAGCGATCTTGTGCG
AGACAGAAGACCTAGCAGAGCTTTGTCGGAAGTATTATTGAGATGCCTTAACAAGTCCTGATATGTCTTATCAGATTTGTACccttcgacaatttctttg
ccCACTGTAGTCTTATCTTGCTCTCTGGTCGTCTGTACATCTTTGCACTGTCGACATGAAGGTGCatgtttttttctctttttccTGGACTTTGGATCAT
AGCTCGGACGTATTGACAGCGCATCGGCTTAGATGTTCGTCTTGCCTGGCTTGTAGTGTACGACAAAGTTGTACACCGCAAAGCAGGAAGAACATCGAGC
CATTCTTTGCGATAAATGATTAGTCTTTGCTGCCGTACGTAGTACGGCATGATCTATATAGATTGCAAAGCGCTCGTCTCCAAGTAAGTACACACGGAAT
TTGGTCAGAGTATAATTCATTGCTAGAAGCACAATGTCATGAACTGATTAGTTCTGTTCCACGGGACGGGCTGGTCGCGACTGAAATGAAACAACTCGCT
CTCAACTTTCATCATCCAGTTGTATCAACGCACAGCCGATTGCATAATCACTTGCATCACAGGCCACGTAGAGAGCTACATCGTGGTTTGCAATCGCAAA
GGTTGGAGCAGCCCTCAAGCTTTCCTTCACCTCGGCAAATGCCGCCTGATGATCGTTTGACCATTCCCCCCCCCAACGTTCTTCTTTGAAAGATACCTTA
GGGGGCTGCACCATCGCTGCATAATTGTGCGTGCAATTGTGCGAATACCCAACTATTCTCTCAGCTATTTCACATTGTTTGGCACAGGCCCATAAttgat
agctttgactttcttcAGATCTACGCGAATGCCATTGTTGCCCACAAAGCGGTCGAGAACAAGGACCTTAGAAGCAAacaaaaagcattttcagGTTAGC
GAGAAGCTTACTCTCTTGCATAACTTGAAAgacttgacgaagatgattaAGATGAACATCGACACAAGACTTCTCGTCTGTCTTCTTACTATGGAACGAA
TATATTGTCAAAGTTTATCGGTGCAAATTTTCTCAATCGACGAAAACGGTTCGTGACCATTATGTTGAATGTCGCAGCAGCATTTTTCAAACATTGTGAC
TTCACTAACCATTCCCACAGCATATTATATGGGGTATTGACAGCGGTTTGTGGTGATGTATTTCTGCGCATTCGTATCTGATAGAATCCATCTTTCAGAT
CGATCGCACTGAAAACCGTACTGCCAACAGTTCCATCAAAATCATATTTTTGCGTGAAACCGGAGTTTGGGCAAGTATCGTGGCAGCGCTCAATTTATAG
GAAGCGTGAACATTGCGCCAATCACTTTTGGCTTTCTTCTGGCACAGAAAGTTGAACTGCAATGCGGAGATTTGCTCTCACGGACATGGCCAGCCTTCTA
TCGCTGCGCAANNNNNNNNNNatgctccttgggcaggggccattggcgtgataCGCAGTATTAGAATCcaagaaccaggtcgatctcatgacgcacacct
cggcctgaaggtaggaccg