Description :
From Genome Similarity Track
Location :
contig_65:51409- 53224
Transcript NameFunction/comments
g11199.t1hypothetical protein

Sequence
1815 bases(100 bases per row)
AGGAGCATAAAACACCGTGGCCGCCTGATCGACATTCATCAGCAGTTTACGGTCGGCAATACGAATAGCTTGGTGGTAACCCCAACACAGTTCTTTGCCA
CCCTTGAGCGGGAACGTTTTTTTCATGGAGAAAAAGTTGCGGCCCACAGCGATCAAGCGCTGAGCTCCAAGATGACGTGCAGCCACATCCAACGCCTGGA
GGACCGGCATAACATTCACATCCGGGTTGGAATAGTAATCCGTAAGTGAACTTGTCGAGATCGTCTCGGCGAGCTTGATCTTCACGACAAATGTGCGAGG
GCCTCGGAACGGGCGGCGAGGCGCATCACCTGCAGCTGGTGGCGGAGGAGGCGGAGGGGTCGGACTGGGGCCGTCCGGGTTAACGTCGACGAAAGTCTTG
GTTTGCGCTTCCCACGGTATCATAGCAGGCGCATACATGGCAGACATACCGTCATGCACAACGCGGATGCCACCAAACTCAGTCTCGTATTGACGGAGAG
CAGCGTTGATCACGTTGCGAACCAGAGCGCGTGGAAGGGGTCGTTCCGGGCGCTGTTCACGTTTAGGAGGTGCAGACACGTCGCTCATTTCCACGTCCTT
GTCCTCTTTTTCGTCTTTACCCTCTTGCTTTGGTTCGTCACCCATGGTCTCATCCTTTTGGTCTCCAGGTGTACCGCCAGAAGGACCGTACTTCGAGTCT
GCTGCGAGGTCAGGCGAGCGCTCGACATCCACGTGGTATTTGAAAATTTCTGCTGGAACCGTGTCGAGCGAGACACCGAAGTAGTTCACACTCAACTGCA
TCGATTTGCCACCTCTGGCGACGCCCGGGCGGCGACAAATAAGAAACTCCTGCTGGAGCTCCGGGTCTTCAGCGCTTACTTCGCGCACGCCCGCGCGACC
AGTCCACTCGTCCTGGAGACGCGGGTCAGCCACGGGATCACCCAAAGTCTCATACCCGGAGCCAGTCACCGTGCCAACACCGGGGCCTGACTCTCCGCGG
CCACCGCGACCCCCACCACCTCCAGAGCGACCGCCACCGCGGCCTCCACCGCCGTATCCACGATCTCCTCCACGGTCACCTCCACGGTCACCTCCACGGT
CACCTCCACGGTCACCTCCGCGGTCGCCGCCACTGCTACCACCGTATCCACGATCTCCTCCACGGCGATCACCACCTCCACGATCATCGCGGCGTCCGTA
GCCACGATCACCTCCACGATCTCCACCACCACCATAGCCACGATCGCCGCCACTGCTAGCACCGTATCCACGATCATCACGGCCGCCACCAGCAGCCGCT
CCACCACCATATCCGCGGTCATCCCGGCTGCCATATCCGCGCGAGCGGTCATCATGGCCACCTCCTCCATACCCTCGGGAGCGGTCGTCATGTCCGCCGC
CGCCTCCCCCACTGCCATAGCTTCCACTGCCTCCGCCATAACCACGGTCATCATATCCACTGCGGCTCTGATCATAACCTCCAGAGGACGCAGAGGCTGC
ATAGCCACCTCGACTATCGTAACTTGATGATCCTGCGTATCCCCCAGAAGAGCTGCCGTGCCCTCCACGATCGTCGTACCCCGACCCTCCGTAGCCCCCG
CTGCCGTACGATGCTCCTCGACTGCGGTCATCGTAACCACCACTACCGTAACTCCCACTGCCAGAGCCGTAGTCGCCCCCTCTGCTGTCGTACCCCCGAG
ACCCCGATCCAGAGGCACCGTAACCCCCTCCGCCGCCGCGACTGTAGTCGTCGTACCCCGACGATCGCGAGCTGTACTCGCCGCCACCGCGGGAGTCGTA
CCCCCCTCTTTGCTG