Description :
From Genome Similarity Track
Location :
Scaffold_141:51407- 53230
Transcript NameFunction/comments
Sapdi_VS20SDRG_16641hypothetical protein
Sapdi_VS20SDRG_16642hypothetical protein

Sequence
1823 bases(100 bases per row)
ACAGTTGGGGACGCACGCATCAAAGCACGCAAAGATCCCCGCCTTCCACTGACCAATGAGGATGCCGTTCTGGTCGACGTTCTCACCTTGGCTGGTGGCA
TACTTGCCGTTTTCAAGCTCGTACGGGGTGGTGTTCATGTTTTGAGAGGGCGTTGAAAGCTCGAGAGAAAAGCAATTGTGTGTGGCTCGATGAAGCGCAC
TGGAGTTAGCCGAGAGATGAACCAATAAAAATCCAGTCAACGAGACACGATCAATGAAACTCGTGTTGGAATAGCATAGCAGATGTCCATTCGTAGCGCA
AACATGGTTCTTTTTCATACGTTAGCCAGCACCAAAGTTTGCACTACTAGTAGAATAGACTGTCAAAGAGTCAGAAGTGTCAACTGAGATTGTTAGCAAA
AGTCTAGGTAATATATACCAAAAGCGCTGAAGAACTGACAACACCGTTGCACAGATCAAGAGAACGAGCGTTGCAACTCATTTTCGCTAACCGTTAGCAC
AACAATCAATGCAAAGACAACTCCAAGTGACAAGTTATGCGAGGAGAACTACTCGCGTGTCGACAACAACCGCCTACAACGTCCTGTCGCAGCAAGCTAT
GACCATTCGTTATCTCCAACGAGCGAACCAAGTCAATGTCAGCGGCGTAGTACGCGTTGAGCAGTAGCATCACTGGACACAGCGATCGGTCGATCCCCGC
TCAATCACCCCCAGCAACCAACAAAGTAGTGTGCACAGTCTTTGTATTTACATTCAGTTATGACGCAGTCACCGATTGGAGCGATCAACCAAAGCGCTTG
GTGGGCACGCACTGCGAGTACCACTCGTCCTGCTTGATGCACTCGAGGCCCGTCGCACAGGCCACGTTGCCCGTGTAGTCCTTGCCACCGCACTGCTCCC
ACGCCTTCTTGGCGTCCTTGACGTCAATCGGCTTTTGGGTCGGCTTGTCAGTGGGCTTTTGGGTCGGCTTGTCGTTGGGCTTTTGCGTCGGCTTGTCAGT
GGGCTTTTGCGTCGGCTTGTCAGTGGGCTTTTGCGTCGGCTTGTCAGTGGGCTTGTGCGTCGGCTTGTCACTAGGCTTCGGCGTCGGCTTCTCGCTAGGC
TTGGTCGTCGGGTCCGAGTCGTCCGGGTTGTCGTCCGGCGACGGCACGTCCGTGGGCACAGGCGACGCCGTCGGCTTGGGCTCCGACCCGCACGAGTCGC
TAATGTAGATATCGGCGCAGTTCCAAAACTGCTCCTGGCCGTTGATGTCGTCGTCCGGGTTGTTCCAACCGACGTACCACCAGCGAAGCACGCAGTGCGA
GTCGCCGTCGCACTTGACACCCGACGGGAGGTTGTACTGCATCGAGAACTTTTTGTTGCCGCCCGGCAGCTTCCACTGCGCGTCGCCGTTGGGCTGCTTG
AGCTCTTGGAAGCACTCTTCGGTCTCCTTGTCGTCCTTGCTGTTGAGCTTGCAGAGGCCAAAGGTAAAGTACCCCTTGTGGTTGGCCGTGATCTGAATGT
CAATGTCCATGGTCGCACCCGGCTTGTAGCACGCGCCGACGGCCTTGGCGCCGTACTTGGGGAAGAGACCGTACTTGCCACCCGTCTCGTGATGGCGCGC
GCCGTTGTACGGGTCGCCGCAGATGCCGTGCTTGCCGCCCTTGGTGCCGCCGATGCCACCACCGCTGAGCCCATCGTCGTCATAGTCTTCGGGGAAGAAG
CTAAACTGCGGAAGGCGGAACATGTGGCCGCGGTGCGGCGGGTGGAGCATGCGGCCGTGGGCCTCGACGGGCGTCGTGGCGCAAGCGAGGAACGCTGCGA
GGAGGGCCGTCGTCTTGAGCATC