Description :
From Genome Similarity Track
Location :
contig_65:51406- 53221
Transcript NameFunction/comments
g11724.t1hypothetical protein

Sequence
1815 bases(100 bases per row)
TCCATCAGCTCCTTAGGAGCGTAAAACACCGTGGCCGCCTGATCGACATTCATCAGCAGTTTACGGTCGGCAATACGAATAGCTTGGTGGTAACCCCAAC
ACAGTTCTTTGCCACCCTTGAGCGGGAACGTTTTTTTCATGGAGAAAAAGTTGCGGCCCACAGCGATCAAGCGCTGAGCTCCAAGATGACGTGCAGCCAC
ATCCAACGCCTGGAGGACCGGCATAACATTCACATCCGGGTTGGAATAGTAATCCGTAAGTGAACTTGTCGAGATCGTCTCGGCGAGCTTGATCTTCACG
ACAAATGTGCGAGGGCCTCGGAACGGGCGGCGAGGCGCATCACCTGCAGCTGGTGGCGGAGGAGGCGGAGGGGTCGGACTGGGGCCGTCCGGGTTAACGT
CGACGAAAGTCTTGGTTTGCGCTTCCCACGGTATCATAGCAGGCGCATACATGGCAGACATACCGTCATGCACAACGCGGATGCCACCAAACTCAGTCTC
GTATTGACGGAGAGCAGCGTTGATCACGTTGCGAACCAGAGCGCGTGGAAGGGGTCGTTCCGGGCGCTGTTCACGTTTAGGAGGTGCAGACACGTCGCTC
ATTTCCACGTCCTTGTCCTCTTTTTCGTCTTTACCCTCTTGCTTTGGTTCGTCACCCATGGTCTCATCCTTTTGGTCTCCAGGTGTACCGCCAGAAGGAC
CGTACTTCGAGTCTGCTGCGAGGTCAGGCGAGCGCTCGACATCCACGTGGTATTTGAAAATTTCTGCTGGAACCGTGTCGAGCGAGACACCGAAGTAGTT
CACACTCAACTGCATCGATTTGCCACCTCTGGCGACGCCCGGGCGGCGACAAATAAGAAACTCCTGCTGGAGCTCCGGGTCTTCAGCGCTTACTTCGCGC
ACGCCCGCGCGACCAGTCCACTCGTCCTGGAGACGCGGGTCAGCCACGGGATCACCCAAAGTCTCATACCCGGAGCCAGTCACCGTGCCAACACCGGGGC
CTGACTCTCCGCGGCCACCGCGACCCCCACCACCTCCAGAGCGACCGCCACCGCGGCCTCCACCGCCGTATCCACGATCTCCTCCACGGTCACCTCCACG
GTCACCTCCACGGTCACCTCCACGGTCACCTCCGCGGTCGCCGCCACTGCTACCACCGTATCCACGATCTCCTCCACGGCGATCACCACCTCCACGATCA
TCGCGGCGTCCGTAGCCACGATCACCTCCACGATCTCCACCACCACCATAGCCACGATCGCCGCCACTGCTAGCACCGTATCCACGATCATCACGGCCGC
CACCAGCAGCCGCTCCACCACCATATCCGCGGTCATCCCGGCTGCCATATCCGCGCGAGCGGTCATCATGGCCACCTCCTCCATACCCTCGGGAGCGGTC
GTCATGTCCGCCGCCGCCTCCCCCACTGCCGTAGCTTCCACTGCCTCCGCCATAACCACGGTCATCATATCCACTGCGGCTCTGATCATAACCTCCAGAG
GACGCAGAGGCTGCATAGCCACCTCGACTATCGTAACTTGATGATCCTGCGTATCCCCCAGAAGAGCTGCCGTGCCCTCCACGATCGTCGTACCCCGACC
CTCCGTAGCCCCCGCTGCCGTACGATGCTCCTCGACTGCGGTCATCGTAACCACCACTACCGTAACTCCCACTGCCAGAGCCGTAGTCGCCCCCTCTGCT
GTCGTACCCCCGAGACCCCGATCCAGAGGCACCGTAACCCCCTCCGCCGCCGCGACTGTAGTCGTCGTACCCCGACGATCGCGAGCTGTACTCGCCGCCA
CCGCGGGAGTCGTAC