Description :
From Genome Similarity Track
Location :
Scaffold_2158:514- 1847
Sequence
1333 bases(100 bases per row)
CGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTATCTGACTCATCCTCCGCGGCGGATTCGAAGTTCGAGG
ACGCAGCTTGGCTGATCCTCGGTGACGACACTGGATCCATAGTACGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGA
TACTATGAGATTCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAGCACACCAGCTACGATGCCTGACTCCGTAAGCAGACGTAATAGATCTTTGACTGCC
ACCAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGA
AGTCGTGTAAAGCCTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCAT
CTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCA
AATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGA
AAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGCCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAG
CGTCTTCGTCGATCCGATCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAA
GATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAG
GGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAG
TGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAA
TATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGCGTTCCTTTGCGTTGTACTTG
CCGCCTCCTATGACGGGATCTTGAGAGTTGAGA