Description :
From Genome Similarity Track
Location :
Scaffold_76:51399- 60511
Sequence
9112 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATG
TGTGTAATAACGCGGCTTGTGTAGCTTACATGTACTAAGTGCGATCTAGCCTGTCCTTCATTATATATATAGGCATATCACACTTTAATAAGGTCAGTAT
TGTGACGCACGCACGTGATTGGCTTATAACCGATCAAAACTGAATATGATCACATAAGCAAATGCTAGACGCTCATAAGCACAGGCCGATCGCGTTGCCC
TACCTTACTGTACAGGTTTAATACAGACATTAACAATATCGTACTCATTCTTCATTGACTGCTGAAGTACAGTGTTTTGCGACTTGATTCAGTTCTCCGA
ACTGAATTACTTATATCAAATGGCGATCTCCAGAGCTTGCTCCCCTATCTTATACGTAATACGTAACAAGTCGCGAGGCGGTACAATGAATATACGAGAT
GGCATAATGCGTGGTGCCACTTTATTTAGTCCCCACTTCCAAATTTGCGCCAGATGGTGCAAGTAACCAATGACAGCGCGGCACGTGGAGGTGTGTCCCC
CAATTTTGACATGAGCAGCGGGCTTGGTACAGACGTTTTGCGCCCCCACAATCCCCTTTCCCACCTCCGCCAGCTCCTGACGAAGGCTCGATGGGTGAGT
CTGTGCACTCGTGCGTCTCTAATTCATCGATAGTCCCTACGGGAGTTTCTGATGACTTCAGCTTACCCGGTACTAATTTGCCTACCTCCCCTGACCGCCG
ATCTTTTAGCTATAAGGACGCGGTCGGGTAGAGCAAAGCCTGTGGGACCATGGATGTTAAACAGAAACTCTGTGTCAGGGAAGCAACGCGGCCGTGGAAG
GCCAAGCCAGACTCAGATCTACGTCCGATGCTTGCTGTGAAAGAAGAAGCTCTAGCCGCTTGGATCATGGGAAGCATAGTGCTCCCTAGCCCTCCATGTT
TTCTGTCGTGTTCACACAATTGTGTAATGCGAGTGGCGACGCTTGACTTTTTTTTAACTTACATCGAAGGAAGCCCTGCAGCTATTGTTCGTCCCAAGGT
TCGTATGCCTCGCTTCATCGCCGGAAATACGTTTCTCCTCCAGCTGTTGGAGGGCAATCCAGAATCTATGCTGGAGGCGCTCCTAACTCGCGAGCTGGTT
CGCGCGGAGAAACGCACGAATTACGATGGGTAACGCGTCGACTCACCTTTACACTTGATGATAGAGCGGCTGCATTCGGCTGGCACTCCAAAGATGTAGG
GTACAGAGGAATCAACCTGCGACTTCAATGTCCCGCAATCCTTGTGCGCGAAGACTCACCGCTTCATGTTCCTGACAGTAATGCTTTTGGTGGCGATCTG
CTATGATACCAGGTTTGGATGCTTGCCACTGGATTATATTCTGGTGCAATTGAAGCACTTCTATCTGCGAGTGTCGAATGTTCAATTGTTTTGGTCTCTC
GAGCGCCATTGGCGCTTAATCACTTGGATGTACAGGGACGGCTTGCTCACATTCAAAGAATATCCATTTCTCTGAACGAAACGAAGAAAAAGTTACAGGA
CAACGCTCGCAAGACGCCACTCTTGGTTCGTATGTCTGGCCAAGCACCAGGTGAATCGAAGCAACCGGATCGACGACCACCCTTTTAAGCTTCAGCAACA
CGGTCTTGCCACTACCATCAGGATGCAACTAACAGGAATGGCTTCCCATCCCACCGACGGCTGGTTTGATCCTGGGGACAGAAGAAAGCACAAAACAGCA
AAGAAAACGACATACGCCGGGCTACCATGTATGCGACGCCTGAAGCGAGTCCCACTGAGCCCATTCTCAAGGAAGTGGCACATGATATTGCTCCCGTGAA
AACTGGGCCTAAACCGAAAGCCGCCGAACGGAAATACTTTGTCAACCCCAGGTAACGCCTTCTCCGAGACATACAATTACCAAGCCTAAAAGGCCTACGC
AAACGATTTTGCCACCGCGACCGGAAAAAAACTTCTCCAAACGATATGGCAGATTTAAACTTTCCTAAGGCGAAACCAAACACTGATGCCCTAGCAGTAC
TCAACAAGATACGCAATGGTACAAGTGCAGACATAAATACACCATTAAAGAAAAACACGTTTGTGTAGCGGGGACGATACAAAACTCTTTGTCAAGCTTA
CATTGTTGACCACTCAAAGCGGATGCACTGACCGATACCCTCGTGGTATTACGGTCCGTTGCATTTACATTGCATAACCGATTCACCCTGGCGAAGGCTG
CCTATCATGAAGAAAACAACGAGTTGATAAAAAGTTCATTCTCTCAGACCCGGAAGCGGGGTTTTCGTCCGGTTTGCATCAAGCTGAGGAAGCAACCATT
TTGGACCTTGAACATAAATTCCGGGTTGCAGCCTCTGCCGAGGCCGTCACGTAAACAGAAGCTGAACACCGTTGCTTGGTGAAGAAATTAATCGTGTGCC
ACCCTCCGATTTACTGAGCAAAGATCCTCCTCCTTTGCGCTGATGAGCATCCGATGACTGTTAGCGATACGCCTGAATCGATCGCTGATCGTTCGCGCCA
GCATAGCAGAGAGGCTATTTTCGGATTCGTCTTTAATTCTATGCGAAAACGCCATCATGGAGCCCCTGTCCCGTTGAAATCAACACAGGATGCTCATGAC
TCGGAACCGATGGACCACCACATCACCGGAGTCGGCACCATTACCGAGGACCCTAAAAATGTTAATCGCACGTCTGTGGATGACGCAGTGAATTGTGCAA
AAAATGTTTACGCAACCCCGGGCCGATGTGGATATTAATATGGAGTCGGTATGTATACCCCAGAACACAATGCGACTAGACGAGCGCGGTAATAACTGTA
TCAACAGAGCTGGTTGAGGTACGGACACACGAGAACCTGAGATTTTGTAGGAAAGGGTCCCGATTCCTGCGGCACTATCAGCGACTTTTGACTCAGAGGA
CCAACCTAAACCACTAAACGTGCTCCAGGGATGGATCCCGTTGAGACATCGCCTTCATTTGAGCTAACGATATTTCACGGTCATGGAAATGCCGCAAGAG
CTGCTGACAAGCACGCACGAGCCCTCACGACGCCCAGAGCCCGCAAGTACTCGATGAATGCATCTCCGATTATATCTGCGGCTGCACTGACTGAGGGTTC
TCGTTGCGAAGCAGCAAATTTATCGGTGACCAAGCAGTAGATCATGGACCGCTCTTGTGTGATCAGTATACCTCACGCGTTGCCTACTACTGCTTCTGGT
CAAATAGAATGGATCCGGCATTATTCTACGGAACTTGCAAGACTTGTGAAGGCGCTACCTTTTCCGATCCACTATCTATATTGCATGACGCCAACGTCTC
TAAAAACATTTGGGCATGCCATCAACAGCGAGACACAACATGCGATCATTGGCCGGTATGCTACCCATGCCGACTCAGGGATCAAACATTTTTTGCAGTT
CATGGGATGCGGTGGCATCGCATCAGCTAGGAACCGTCAGGTGGAAGAATACGGACTCAATACAACGATGGAGGAAAGTTCATTAACAGCACCCACAGTT
GCTGTGCGCAACCGTCGTTGAACCTATCGCTATCGATGGCTGGGACGTTTTAAATGTTCCCTGCTTGATGCTGCCAACCCTGGCACCAGCGAACGATTCG
TTTGCGGTCGTAATGCCTCAGACAAAAGCGTCTATGTACCACTCTTCTGTCGCGGTACACACAGCCGTCTTCGGTATTGTAGCCAAACAGGCAGACTGGA
GTGAGGCTACTAATCTCATCGCGGATGAGAGTCGGGCTATTCCCTACCGCTCCTAAGGGAACCGTTGGTTATCTGCTGCTGCGTCCGTAATTATACTGGC
CCATATGCTAACTAGAATGCGTAACATGTCTAATTGGCGTATCTTTTACGACCGGAAGGATTCGTCCCATTGCCTAAATGTGCCTTACCTGTTGATCGGA
CTAGACGTCTGCTGGAAAACTCGATTTGACCTCACTCCCAGAACGTACAAGGCCTTCCCAAAGACTCAGTGCTTTGCGCACAAAGGTTCTCCAACTTCCG
TCAGCATTACGAGTAGGGGGCCCTAGATGTTGTGCTGCTTCAAGAACGTACGTTTTAGACGAAGAGACACATGGAATTGGTTCACTCTATTGTGCTACAT
GGGGTTTTAATCCTGACGAGAAAAGAGGTATTACGTTTTGGTCGGAGCCTTCCAAGCGTAGGGAGGGTGTTACAATACTGCTCAATCCATACTCAACAAT
TCAGGAGATAAGAAACGCCATGGTTGGAGGAGGCATGGACATCGCATTAGATGGCGGCGACTGGCAGGATACACACCGAGGATTCCATAATGCTGAATTC
TTACGCGCCAAACGATTGGTATGATCGAGAACGTTATTTAAGTCGCTCTCAACGAAGCTTCAGAGCTTTGACGGACCAGTGATACTAGGAGGTGATTGGA
ATTGTACTTGTTACCTAATCCTAACCGGTCATATGTTACTACCAACGGAATCCATCATTATTCCCCTGAGTCACGCCGTCTACTGGATTTCAAGGAGATT
GTGAGTGTGCTTGAGGATGAAACGGATATTTTGGTAGCAGAGCGCAATCACTCCGTTTTTCAAGCAAAAACGCACACATACACATACACATTGCCGGGAG
GAGCGCAGGCAAGCTCTCGGTTAACTCTCTGGTATGTTAGCGTCAGGGTGTCCGACTGGATAGGAGATATCAGCATGGCAGTCCCCGGTTCAAACTCGGA
TCACAGTAAAATTAATGTCCGAATCGCAGCGCCGAAAACAGTAGTTCAACATTTTAAATCACGCCATTTATATCCAGTCGCGGCTGTGGTGCACGCTACA
GCTAAGACCACCATTATAAATGCGATAACTTCAGCTTCACGGACCCTTGAGGCAGTCCTCAATTTTCTTATGACTGATGTATCTACGGCGAACAACCTAA
CGCAGTGGTGGGATGAGTGTAAAGTGGGTCTCCCCAGAGCAGTACTTAATGACTCACGCACGATACGACAGAAGAGGACAAATAGTTACCGTTAGCAATT
GCGACGTCTTAAAGTGAATCTTCACGCGGTTAAGGTCGATAGCAGTAATAACGGCGAGACGGTTACTATTGTACGCCACAAGATGGTCGAATGTCGTCGA
AACTGGCAACGGTGGAAGCGGGAACAACTACTTTGACAACACACGTACAGCCCTAGAGCTACTACCCGCCGGGTAATTGCGCAAGTGTCTGCAAAGTTTA
GAGACAACACAATTGCCATACTAGGCGGAGCTGTCCCCTACGGCTCCAATCGGTTGAGAGACATGGCTAATGGGTGGACAGGTTTGTTACATCGACGCAC
CCGTGATACGAAGTGTACCGAGAATTTTCTTTGCAAGAACGCCAACGCCTCCGTCGTTAGATGGTGCAAACGTGGTATCTGCAATTGATCCTTCAGATAT
CCTAGCATCTATATTGAAGTGCAAGCATGGAGAGGCTTCCGGACCAGACAAAATTGTCAATAGTTTTCACAAGGGTTTCTCTGGAGCACATGCACCCATC
CTGGTGGAATTATTTACTAAATGGCTTAAGTGTGAAGTGACGACTTTCTCCTTTAATCAGGCCAATATTCTGTGCCTCAAAAAATGATCAACGTCTTCTC
GACCGCTTGACCACCGGCCAATCGGTTTACTCAACAGCGACTACAAAAAATTTACCAAAATTCTAGCTACCAGGCTACGAGCGATGCTGCTTTTAGTGTT
TGACACTGCACAAATTGAATCTGTACCAGGTAGCAATATAGCGACCGCACTCGACATCTTTGCACCGGCAAGGATCGCCGCGAAGAATGACGAAGTCATA
AAAGATGCAATCGTCCTCCTTTTGGAATTTGCTAAGGTGTACGACACCTTGCAGCGACACTTTTTACTCGCGGTGCTTAAATTGTTGGGGTTTCCGAATA
CTACCTGCAGTTTCCTTGTCAATGGATTTCTATCTTGGAGGGTTGAGATAAATTGCGGGATCACACAAGGCTGCTCAATGGCACCTTTGCTTTTCATTTT
CGCCCTAGACAGCACGCACAAGGTTTTGCGCATATGTTTAGATATTCACGGAGTGTGGATCACTGCAACTGGAAGGGCATAAACTATTGCTATATCCGGT
TACGCTGATGACACAGCCGTTTATCTCACCCACTATCGCGAGGTTCCTTAGGTGCTTGAAATATTTAAAGCGTTTAAAAATGTATCGGGGTTGGATATCA
ACACAAACAAGT