Description :
From Genome Similarity Track
Location :
Scaffold_1:5139741- 5146425
Transcript NameFunction/comments
Phyin_T30-4PITG_00858Serine/threonine protein kinase
Phyin_T30-4PITG_00859Putative uncharacterized protein
Phyin_T30-4PITG_00860Kinesin-like protein
Phyin_T30-4PITG_00861Putative uncharacterized protein

Sequence
6684 bases(100 bases per row)
GTGGCGGCGCCAATGGGAATGGCGTAGACCAGCCAGCTATTCGACGATTGCGCTCCGTTGTGGGCTCTCCGCACTACGTGGCGCCTGAAGTTCTCATGGA
TGCTGGTCAAGGATACGACGGCGCCAAGGCAGATGCCTGGTCCATTGGGATTATCCTGTACGCGATGATTGCGGGCAACCTGCCGTTCGGGAAGGATCTA
CTCAAGTGTGTACGCTACGATCGCTTCCGGAAATGGTCGTACAATACCAAGTACAGTGACGACGACCCTACCGACGAAGTGGAGTTCCCGACGTGGTTCT
TTCCCGCGCATTTCTCGATGGAACTGAAGTCTCTGATCGCTCAGTTACTCTATCCGGATGCCTGTATGCGGTTGTCAGTGGAGGAAGCGCAACGTCACTT
GTGGGTACGTGGCGAGAAGCTCAAGAAGCCTTGTCCGTCATCGGAAGACGATCAGCCGAGCAACAGTGCAGTTCTCAACACTCCCGGTCTACCGCCAGCG
CCTCATTCAACGTACAAGAATCGTGCGAACGTGGCGATCAACACCTTGCAGGACGGGCTTGAGCTGGGGCAACACATGCATCCAAGTCAGCTCGGTTCCG
TGTCTCCTCAGGCCATCACTCGCCTGCTCTCGAAGGCTCCGAGTCCTCATGGACACGCGTTTCGATGCCCACCGTCTCCACAGCAAACCCTTCGGGTGAA
CAAGCATCTGGCTGGCGTGGTTGGCTACATGCCTTCAGTGGACGAGACCTCGTCCATGTCTGGTCAGACGCCTATCAATTCTCCTCGTGAGGTCAAGAAC
AACGACAATTTTGAACTGGAACGCGAGGTCGATGCCTCGATGGCGTCGTCCACAAAAGAGCTGAATGCCTGCAACATCTCGGAGGCCGGAGCGCTGTTTA
AACAGGAGGCACTTGTCCGAGAAGCTACCGTCACTACCTCCATGAGTCTCGCTGTGAGAGACGTTGGAAGTGCTGAAAACGTAGCCACGGCTCAACGACA
CCAGCATCGCTTCGTGTCGCCTCCGCTTGTGTCTGGATCGAGGGATACGATGCCCATTCGCCTCCGTCGGAACTCACCGCCGGAATTGTTTCTACGTGGC
TTCGCTCGAGGACACTTTCGAGAACTCTCGAAAGGAGACGTCGGAGGCAACACCAGTGGCTTTGACGGGATCAATATCCTCGGTCGCTCTCCTCCACTTC
TCCCACAATCAGTTGGGGCTCGAGACGACAAGCCCGGTCTTCCTATCAACCGCACGTTGACTGAACCTCTTGGAGCTGAGGCTCAGAGCAAAGGAGAGCA
GCAAGCGACCAGTGCTCCACCTCCTTCGTACAGTGATCTTGTGCCACGTTCGACACGCTTCTTGACGGCGTTACCGGCTCGCTTGGTGCTCTCGAACATC
GAAAACGCTTTGAAGGCCACCCCTTGTCCACTGCCGTACGAGCATCCGGAAGTTTTGCAGAATGTGGCCATCGATTGGGACACGTACCAGCTCGAAGTGC
GGTATACTGGTCTCCTGACCTGCACGGTGCAAGTTTTCCTGTTCCAGCGCGGTGTTTATCTTGTCGAGTTCCGACGTGGCCACGTACGTGCATTTGTATG
ATATCTATTGTTGTGGGCTTATCTGACCTAGAATGTTACATTTGTTACAGGTGGATATCTTTCAGTTCAAACGCTTTTACGAAAAGATCCGTGCGCAGAT
CTCGGAAGGTATAGACGGAGGCTCGGAACGACCTGCACCGGCATCCCGCAAACGCAACAACTCCGTCTCCGAGACGTTTTAAAGTGAAGACTTCGGTGCC
GGATCCTTATACGCTCACTCATCACACAAATTCACTCCAACGTTTTTCGTTTTTCGCTAGTAATTACCAATGTGATAGTATTATTTTACCTTGCTAGATA
ATGATACCCCACAATTTATAGCAGTGTGGTGTTACGTAGCGTTCAAATATTTCATTACTTCAGTTGCGCATTCTTACTATGCTTACCACGAGGCTTGTGC
CGCTTTTTGAGCGATTTGAGGTAAGGTTCGGCTAGTGATTTCGCGGGCGGAGTTCTTCCCAGTGCTGAAACTTCAGCAAGACTGCCGGATGTGCTTGGCT
GAACGTACAGTGGTATGGGATTCTTCTTCTTCCGACGAATGTAGGGGAGTGAAGCGTTGTTCAGGTGTATGCCCCAATGTTTGTTGCTGGTCACAGGAGA
CACTGAAACCTTGTGCGCGACTTCTTGATGTTTGTCACGATTGCTATTGGACCGACTCGGGTACAGATGCTCTCGAAGCTCCTCGAAGAATCCTCTACTC
GTCTTAATCTTCGGCAGACGAACACGATCATTGTCTCGGCCAGACGTTTGAGGTTGGGGGCTGTTCGTAACAGGAGCTGGAAGATCAAGGTGAAGTTCGT
GTTCAACTTTCGAGATAAAACTGACATCTAGATCGGCACTGTACCCATCATTGTTGCCGTATTGACCATCACTCCCATTTGTTTGCAACTCCCGCAATGT
TTGCAGTTGCATCTTGTCGATTTCCAAGTTGCCAATTCGATATTCCATCAATAAAACCTCGCGGATTAATTCATTGCGCTCCATCAACGGACTCTGTTCT
ATTCCTCGGTGGAAATCATCCATTGCTGTTTCATTTCTTGCCAATTGCTGCATCAGCCCCTCCCTGTCTTGGGATAATGACACGAGTTGCTGATCTCTCA
CATCCTTCTCCATGATGGCATTATTGGCTAGTAAAGTTGTCTCGGTAAGGCCCAACACGTTAGTTTTATTCTCCTTTTCTTCGTTTTGAGGTTCTTGTGC
TACAGTTGCAGACTTTGCAGGCCCCGAAGACTGAGTGTCATTTGGACCAGCTGCTTCCTCCTTCGTTTGCAACTCTTTTGTTCGATTTCGAATCTGTTGT
CACAAAAATCATTAGTTTTAACACTTTTAAGCGAAAAAAAATTGCTGTTCTAACCTGATGTTCGAGTCTCAGCAATGCGTGACGTAATCTCCGACGCTCT
TGAAAACATTCTGTAATGTATTGGCGAGCTTCACGTAGTTTTGTCGTCATCCAGTCTTCTTCATCCGCGTTGTTATCCAAATTTTTATTCTCCAAAGATT
TCTTGTTGTCGACCCAACATCGCTCCTCTAATGGACATTGTCGACTAGTTTCTTGTTGCCGAAGAAGTTCTTTTTTCAATGTGGCTATTTCTTTTTGAAG
GTTCGCCACGAGGTTGTTCTGGTTGCGTGACATCTGTTCGGACTCGACGTTCCTTCTCAGAGTCGTTTTGATGTTCTTGGCTCTGTTGGCATATTTAAGA
GTGTTCAGTGTTTCCTCCACACTTGATGCTGCGAGACTCACGTTGGCAATCATCACTGTTCGACAATTTCCACCCAATGAATCTTTCAGAAGCCTCGTCA
GCTTGCTATCTCGATACGGCACAAATGTCGCCCCTTTCTCTCCAAGAGCATTAATACAATTTCCCAGAGCCAGCAACGAGCGATTGATATTCGCTCCTTC
AAGTAACCTCTGGCCCCGGTTTTGCGTCACTGCAGCTCTCTCACTTCCTGCTAAATCCACTAACGATAACTTCCCAAATTTCACCTCTGTTTCGCAATAA
TCTGAGTCTGCGGTAGAGTCCTCAGGAGTCATTTTCTCTTGCTGCTCTATATGCACCTGAAGTACTGCGTGTGATCGCGAAGAGACCGAGTTAGCTGCCG
TGTTCTCCTGGGACCGGTACTTGTTGCCTCTACGCAGTAGTTTCATCACATCCTGCGCATCATTTGCTTCCACTTCCGACAATCCTGCAACAACAGATCC
TCGAATAGGATCTTCACGCAAATCTAGAAACTCAGACGATGGCATTGACGGTGTGGATGAGCAAGACGAACTGGCAGACAGCAGGTCGCAAATATTCTCG
TTGTAAACCTCTAAAAACGAGACTGTCACTCGGTATCGCACACGTCCAGCGGGGTCTGCGTGCACGCGTTCAATATTTCGGAATAAATCCTCCAATGTTC
TTGCCATGATGCCGGGCTCCTCTTTTGTGCCAAGCATTGTAAATGTCTTTCCAGCTCCCGTGCAACCATAGGCAAATACAGTTGCATTGAACCCATTTAG
CACACCATGTATCAAGAATTTTGTGGTTTGCTGATAAACTTTTTGCTGACCATCATTCGCAGAAAACACATAATCGAACGCATAGCGTTTCTCCCGTCTG
CGTGTTCCATTTGCAATTGCAGGAAAAGCAGACGTGTGTCGTGGTTTTCGATGCGAGTGCAACGAGTGGCGTCTCGCTGAGGAATTCGCAATTGGTATCG
ACTCCGAGCTGCGTGTCAGGACGACGATCTCTTTATTCCCCAGAACTTTCACAATCTCCATGCGATCTCGGTCATGACTCAGGAGCGGACGTAAGCGCAC
GGTCACCAAGATGTTGGCCTGACCCGCCCACATCTTTTGTCTGTAAGTGTCGCTATCAGAGTTTTCTTCCGTCAGAGTCGCTAGTCCATCGCCAGTCTTG
GTGGGCAATTGAGGCAGGAAACTTTTCCGCGAGATCGGTCGCAGATCCGCGACTTCACGCTCGCCTGTCGTGTACAAGGCACCGCCTTCGATTCGAGCAT
GGCTGGTCATGGGTCGCAGTGTCACGGGTGAGACCAGAAACAACCTCGTGCTCTCACTCGTGGGGGTTGAAAGGTCTGGATTTCGCCCCAGCGACATCGG
CTGATTTAGGAAGCGGTGACGAGCTGCTAAACTCTCACAACGATGGCAGCTCAATTAGTGTCCTGCAGTGTCACTATAATAGCGAGCATAATAGATAGTA
TAGGTTTGCAACAGCTTCGGGTCCTTTATATAGATCGCCAAAAGATAGCGAGTTAAAATAGTGCAGCCCACTACCATCTAAAGTTGATTAACAGGAGCAA
CTTGTTTTTTTCGATGAATTGCAATTTTCACGAAAAAAGGTTTTGAAGATGCAATTGCCGTTTTACTGTTTTAAGCCGCTGCCAACCATGGACTTAGAGC
GAGTCATTAACTAACACGCTCACAGCAAGTGCATCGTGATCCCTCACCACACATTAGCTGCTAAGCTAAAATACATGTCATTTCATTCATGTGCTGATTT
CTAATTAATGATTTAATGATTGAGAGCTTACGTAAAAAGTCATAGAGTGCCTAGCTTGACATGCTGTACGCATCAGTGTGAATCAGTGCGCGCCGCTGAT
TCGGCACGACAATCGATATTTACTGCACTGGCAACATATGCAAGACAAAACGGTTGCCAATGGACGTTGCCATTCTTGCGCACATGAAACGGTGGCACAA
ACGTCTGCACGCTGAGATATGAGCGTGGCGAATGTTGAAGCGAGCTCGCAGAGCTGGGGCCACGCCATCATAGCGATCGTCGCGGGGACAAGCCTGCGTT
TTACAAATTTTAGCGACGCATACTGGACTCAAGTCAATCGGGCCGTTCCAATGGCGAGCAGACCGATGCTTGGCAAAGAGATTGGCATCGTGACACGAGA
CTCCCGTCGGGTCCCGACTCGGGAGCGTGAGAGTGCCGCCTCGTCATCCAAATCGGATTTGATCGATCTGTCTTTCCATTGGAAGTTTTCAAAGCGAACT
CGTTCTTGCTTTTCCTTTCCAAGCCGATCTCGCGGATGTGTTGCCGACACACAATGAAACGACAGTCATGGTGTTGCTTGGAGCGGAGACCGCGAGAATT
GTCATCCGTGCAGCGAGTCTCGAGGTGGTGGGGCACCATCATCGACTGGCGCAGCGCGAGCGTAGCCCCTAGCAGTAACACTGCAGTTGTGGACACCAAG
CAAGCATGTGACTCCTTTTTTTTTCTACGATGGGCGGCAATAATTGTCATGTGGAGCTTGCACCGCTTGAAGTGACCAAGTGTCGAGCCAACTTGACATC
GCTGGATGGGCCGCTACTCACGTCCCTTGGAGTTGACTGGCGTGATGGCTCCTTACAAAACGCAAGTCATTCGTCCGGCAGGTGAAATAACAGCTGCTCC
AGATCTGTCACAATAGTTGGCCGCGCCGCGTCTTTGTGCTGACAAGTTTGTGGACTCAGGCCGCTCACGCCTTTGTCCTTCAACCGCCGAATCACTTAAA
GTTTGTAAGCCATTGCTGTTGATTTCCTCTTTGTCAAGTATGTATTGCGTTTGAAAATCCACCGAAGCCTTGATTGTAGGTCCACAGCGCTTATATTATA
CCTGTAGTACGAGTCCTACCGAGTCGCACGTGTGTTGTGCGGCAACTACAGGTTGAATCAACCTACAGTAGTTGGTACAGCATGATGTACGTCATAAGAC
GATGATCAAATTCTTCTGGTCGCCAATGCTCCAGCCGCATGACACCCAACCATCAGGCGGATTATTGGACGAGCTGTTGCCATGGTGTCAATGGTTTTGT
GGGGGCTGTCTTCCGAGTGTCCATCTGCCTCGCCTCGAGGACTGCCAGCAGCCTCTTAAAGGGCGATCCGACCAGATCTTGTCTTGCAACTGCGACTTCA
TGTCAGTCGCCGATGACCACGTCGATCAAAAACCATTTTGTCATGTCTAACGGCCCCACCAAGCCTGGAAGCCGCGTTGAAGCTTGCGAGCACACGGAGC
GCTGGGAAGCGCCGCCCGATCTGCTCGGAGCCGCGGAGCGAAGAAAGCGACCCAAAAATCATTCTTTTGAGCCTCGGCGAGACA