Description :
From Genome Similarity Track
Location :
Scaffold_151:51374- 56921
Sequence
5547 bases(100 bases per row)
ACCTTAGCTGAAGAGGAAGATGCCAGATGCGATCCCCGTGCGGTTAACGTTGTTCGCCATGAGGCCTTGAGTGCCTCAGAAGTCGGCACCACGACGTCCC
AGCCGTGAGTATCGACGTTCCACGTCACGGTCGCCGTCGACGACGAAGCCGCCGCTGAAAGTCGGATTTGAACCTCGTCTAGATCGACGACGCTATCAGT
GACTTGGAGTCCAGGGCCCGGGATCCTCCGACACGGCCGGTTGAAGCGTTTGCTTACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGAATCTGGTG
TCTACTTGGAGCCGTTGCCAGAAGCCGCAGAGATTTTAAACCCGAGGAAATGACTGTCGAGTCTTTCCTGGCCAACATCAAGGATGGGGAGGTTGCCGAG
ATGGTGCTCATAAGATCTGAGGCCACTCGGGTGGCGTTTTCCCCCTCCTCTGTCTTGGAAAAGAACGGCTTGGAAGAGGTGAGGAAGCGCTCGGGCTCTG
AGATCCTTAAGAGCCCCGGAGATCCGGTGTATCCTCTGGTAAACGGAGTACGCGGACGTGGTCAACAAGCGTCCACCAACCCAACTCCCACCAGATAGAT
GCGTACGGTATCAGATCGGTATCGTGCCTGGCACAACGTACTGTGACACGAGACAATGGTATCTTCCAGGCGAACAGTGCGAGGTCATTGATGGCTTCCT
CGCTGCGAAAGCGAAGGCAGGCATGGTGTGGGAGTCAAAGTCCCAGCACTCAACGCAAACGTTCGGAAGCCAAACGGGAAGTGGCGTCTAGTTCACGCTT
ATAACAAGCTGAGCGACGCGACGCTGCCGGCCCAGAACCAATCCCATGAAAGGATGCCTTGTTGAACAACATGGCTGGAACGGTACTGTACAGTGCGCTG
GATTTCGTAGCCGGATACTTTCAGATCCTAATGCGCGAGAGCGACAGCCCGCTCACCACGGTGAGCACTCCATGGGGCATGCTTCGGGAGAGGCTCGTCA
TGCCGCAGGGCTTGCCGAACGCCCCAGTGACATCAACCACCTGGTGACGTAGCTGCTCCGGCCATTGCGTGTCTTCATACAAGCGTATATCGACGGAAGC
TTCGTCCATAACCGCGGTGAGGGAGGCAAGACGGTCATAAAGGTGCATTTGGGGCACCTTCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTTTACG
TCAACATCGACAAGTGCGTCTTCGCGGCACTAGCGATCAAGCTTCTCGGTTGCTTCATCAGCAACGTAGGCGTTCGAGCTGACCCAGACAAGGTCAAGAC
CATTGCAGCATGGCCGACACCCCAATTCCGAAAGGATCTTCGAAAGTGGTTGGGCATAGCCAACTACCTTCGCAAGTACAGCGCAGGGTACGCGAGTCTC
ACTAAACCCTTGCTGTGCCTCCTTCAAAAGGACACCGACTGGCGCGACCAAGATGTCTTGGACAGCTTCAAGGCCAATCTCCAAGGACAGTCTCCAAGAG
GCTTCTGTCCGGGCCCTGCCAGACGAGATGAAGCCGTTCAACGTCGTCTGCGATGCTTCCGACTATGCAAGCGGTAGTGAATGGCTGCAAGCCGGTGCGG
CCGAGTCTCATTTCAGTCCAGGCAGCTCGAAGCCGCCAAACGGAAATACCCTGTCCACGGAAATGGCTCCTGGCAATGAAGTATGCCCTTGTGAAGTTTC
GGTTTTTTCTGGGCCCAAGGCCCTTTGTGATCTACACAGACCACGAGTCCTTGAGGACGGCGATAAATTCGCCTCACCGCTCCCAACGGATGGCGACGTG
GCTACCCTTCATCCCGCAGTACAGCTTCCGCGTTGGGCACAAGACGGGCAAGCCCAACGGGCTTGGGGACGCCCTCTCACGGCGTCTAGCATACGCGTTG
GCCCACATCAAACGGGTGACAACGGATCTATGTGATCGGATACGCGTGACGTATCAGGGCGATGCGGCTGTCCCGCCATTCGTCAAGTTACTAGTTGCAG
GAACGAACGCGAAGTCCGACTGGCTTTCGTCGCGACAGCGTTCCCGCGCCACCGATATGAGTTGAAGTATGGTCTCCTCGATTACCGGGTGGATCCAAGA
CTATTGGAAGTCGATGAGTCTTGCCCAAATCTTTGGGCTCCCGCCGACGGACACGGCAACACCGGGATTTTGATGTCGGCTGAGCAAGATGGTACATCTT
GCACCAGCACCCGTTACCGTCACAGGTGAACGGACCGCGAGGTTGTTCGTCGATGGTGTGTTCCGCTATCACGGCCTCCCGGAGATGATTGTCTCGGACC
GGGACCTGCGGTTCACGGCCGCGTTTTGGAAAACGCTGTTTCCTTTACTTAGAACTCGTCAGCAGATCTCCACTGCGGATCAGCCGCAGACAGACGACAA
GACGGGGCGCGTCAATCGAGCGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGGATCCCTACGTACTTAATCGACGTAGCTTCCAGTCGTTGCGTTTGCT
CTCAGCAACACGGCGCACGCGTCCACGGAGTCCACGCCTCTCTACTTGAATGGCTATCGTCACCCTAGAGTGCATCTCACGCTTCGAGGAGACACTGCAT
TATATATTCTAACTGGGGGAGAGGCTCGGAACGATCTTTCCTCCCAGTTCCCAAAGGGGAGACCGGGAGCGCTGTGGAAACAAGTAGAATACTTGGCGGA
TACCAAGCTGAGCTTGATCAGCACGGCTCGCGATGCCATGCTAACGGCCCAGGACAGACAGAAGGAGGACTCTGACAAAAATGAAAGAGAAAACTTAACT
GTGTTTAAGGTGGGTGAATTAATGCTATTAGACACGAGGAACCTACGACTAGACACAATCGGCTCTGTGGCAAAGCCAAACTGAAGCACCGCTTCATCGA
CCCGTTGCAGTCCTGGCCAGGCATGGTGCGGCGTACACCATCGACCTGCCTAAGTCAATGACGACGCAACCGACGTTTCACGTTGGACGTCTTAAGCAAT
ACTATGATCCGAAGGGGGCTGCTGACTCGCCAACCCACCTTGGTCTTACTCCGCAAAGCGAGGGCCGGCCACAGACGTCGACGAGGGAGTCGGAGCGGTC
ACCCAAGCCTCCGTCTGGACGGAAAGCTGCGGTCAAGACCGTACGCAGGGGCCCCGTACGAACGGACACAGGAGCCATACGCCGAGTGCGTCGAGTACGT
CAGGTACACACCATACGCGTACGACTGCGAGTGCGCCGAATGCGGCTCCGGACGCGGATCGTGCGGAAGGCCTCGTCACGATCGGACGAAGAGGCCCGCC
GGTCTACCCGCAGATGCAGGCTCGCGACGTCATGCTCCAACAGGTCCAGGCGGCCCACAAGACGAGCGAGCACGCCCTGATTCCCGGGCTATGCGTCAGC
ATCACCGCCGGTCCCAAGGACAAGTGCAATCTCAAGCACGAGGACGCGTTAGCAAAGGCGGTCAGCCTCAGGGACCTGCGTCGGCCCAGCAGGAGAAGCA
CTCGGACGAGAGTAGCGATCCGGGAGTGCCTGGTACTTGGGCTCGTATGAGGGAACTTTTGCCACTGTTTCGACAGGACAGGGACGTCTACTACGAGCGG
ATACGCCAGGAGCAGCGGCTTCGCGGAAAGCGTCAGATCCTCGTGAAGTGGAGGGGTTATGGCAACTCCGAGAACTCATGTGAGACGATGGAACGGACTG
CCCGAAGGCTGTTGCAATCTGGGAACGAAAGGAGTGGGATCTTCCCAAGTAGTTCGCGGATACTTGCCCGAACGGAGTACAGACGTTGACGGCACTCCGT
ACCCGCGCGCGCTTTAGAATGTCCCTTGGCAGCATGCGCTTGCTGACCAAGTGGGCGAATCGGATACGACGATCTCGCTGCTCCAGGATGCGAGACAGCA
GCTGATCTTCATGGAGTCCCCGTGACTCCGAGAGTGAGTACTTGAGAGACTCCACCGAAGCCCAGAAGATGTCTTCACATGAGTTCCAGTTGGGACAGTT
CTCAGAAAGAACTCAGGGGTAGCCCCAGAGAGGGTAGAGACCACCCCGATTCTCGGGCTTCTTTCAGGACAAGTCGTGAAGTCCTTCAGAGGGATTCGGC
GTCGCGCGAGAAGCACGCACCGGGCCGCATCCAAGTTGTCGGTAAAGAACCGCTCCTTCTGGACCAGGGCACATTCGTAAACGCCCTTAGAAGTGAGACC
ACCAGCAGATCCACGAAGCGCGACGAGGATCGCCAGAAAGAGGTCTGCCCCAGAGCTACCTTCGGGAGGCCAATAACCTCTTGAGTTAATAGCAGCTCCT
TTGGTTGACAGGTGCTACCACCAGACCTCCACGCATGCGCTGGGCAGCTTGGAAGTACCCCTGCTTGTCAAGGTCGTTCGTGATCTCTAAGGGTTCACAT
ATAACCGCCTCCTCTTCCTCTTCATCCGATGATCCGAAACGGTTCCGATAGGAGTACCCATTCTCCGTCTCCTCGCGGAGTGGATGCTTCGAAGCCGTGT
TCTTCTTAGACGGTATAGCATCTTCGGCGCTGGCTTTGGCGGCCTTAACACGCGCAAGCCCCTCGGCGAGCGTGAGATGTTTGGGGGCTTCCTCCTCCTC
GTCGTCGCCAGCTTTCGGAGACCCCTTAGCCTTGATGACAGGACTCTCAGAGCGCACAGATGTCCTGGGACTGGGGTCACCGTGGTCACTGTCGAGCGAG
TGCACACTGTCGTCGTCGTGCTCGCTAAGATCTGGAGTGTGCCCCACTCACGATGCTCCTGTGGGCTCCGGGGGGCTCCTGGACTCCTCCTCGTCCTCAC
TGCCCGAACCGAATTCACGCTCAGCGAACCAAGGTTTTGGTCACGTGTCTGGAGAGACCGAAAGTGACAGACTGCGGCGCTTGATGCACACTTGATAGCT
GCCGCGTCGTCAGATGAACCGATCGCCTCCGAGGTCACCTTAGAAGCCTCCTGAAGTGCAGAGCCTTTGCCGCGAGGCTTTGTTCTCTTGGCTGCTCCTA
TCCGGCAACAGCCTTGGAGCGGGTGTCCACATAGCCCTTCGCAGTGCCACGGGTTATGCTAAAGGTCGACGTGGAAGAGCGCTCAGGTGCTGCTCGAGGA
TCTTAATGTAAATTGAGCCTACGTCGTGTTCGCGCAACCAAGTCGATGTATGTGGACTTTGAGAATCAGAGTTTGTGACGTACACTTCCTCATTCTGATT
GGTCGGTAAGAGGAACATAAATGGGGGAGGATGTAACGGAGTACGTAACCCAATGGTACCCCTAGTTACATGAAGTGTGATACGTCACACTTAGGGATAT
ATGGTACATGGTACCACGGTCGTCAGAGGCCAACCATTGACTTACGACATAGTTTTACTAAAGTGGTTTATGCTTTATTTATTTAACGCAAGCTTAGACT
ACCTTAAAAAACATTCAATTTACAGCTTACATTATAATAAACTGGTCACTTCGATACCTTTCGGCAAAAGGGACCTGTTAGCTACTGTTCACTGAGGGTT
GTACGCTCTCGGAATTCAACTTCCTCAAGCGCAAAGTGCTGTGTGAC