Description :
From Genome Similarity Track
Location :
Scaffold_819:5137- 9174
Transcript NameFunction/comments
Phyta_totarag10863hypothetical protein
Phyta_totarag10864hypothetical protein

Sequence
4037 bases(100 bases per row)
AAGATGCTGACCAAGTCGAGGATCCAGAGGGCTGCTACCACGAGGGTGGGATGCTGTATGCAGAGGATGTGGGAGGCGAATTGGCGATGTTGCCAGAAGT
GACTACCACGACTGATGAAGTAACGATCGAAGACGTTCAAGTCGGGGATCCAGCGGTAAACACGCCGGAAGAGGTTAACCGACTCCTCAAGATTATCTGG
ACGCGGTGTCATCTCTTGATCGGGAAGGGCAATGCgttgccaccagcagcggtgGGTGCCGTTTGTGACATTGACGTCGGAGACGCAAAACCGATCGCGC
AACGCGTACGCAAGGTGGCAACCCAGTTCCGAGAGAAACTATCGAACCTGATCAAGGGACTGCTGTCCGCCAAAATCATCAAGACGTCCACGTCCCCGTG
GGCATCCCCGATTGTCGTCATTATCAAGAAGAATGGCGTGGATATTAGGCTTTGTATTGACTATCGTTTGGTCAACAGCTTAACGCGACTGATGGTTTAC
CCTATGCCTTTGATCAATAATCTGCTTGAGGATCTAGACAAAGTATTGTGGTATTGTTCGTTGGATATGGCAAGTGGCTTTTGGGTGGTGTCCATGACGG
ATCGCGCTCGCGCTATCTCGGCATTTATCACGCCATTTGGATTGTTCGAGTGGAACCGTATGCCGTTCGGACTCAAGAACGCTCCACAAATCTACCAGCG
TCTACTGGACAACGACTTGTATGGTTTCCTGATGATCCCACCAGTTAACAGTGGAGGAGCCTTGGCTGACCTGTTCGAGATCGGAGAACCGGAGAATCCT
GGCACCATTGCTTAACCGCCGATCctacatcgacgacatcttgGTGACAGCAGGATCTTGGGATCACCTGTGTGAACGGGTGGAGTTGCTGTTGGAAGCC
TGTGACAAGTGGAATATTTCGATTAGTGTCGCCAAGAGTTTTTGGGGACTGCGCAAGGTGGACTATTTGGGTCATCAGGTTTCAGGTGAAGGTCTAGAGG
CTCACCCGCACCTCTGGTGGATCTTCCCTTCCCCCGATCCCTTCGCGCAATGCAGCCATTTCTAGGCAGTCTGAATTACTATGGACTCTTCATCGAGGGT
CTGGCGATATATGCTACTGTCCTGTATGAGTTGAGAGAGGTGGACTTTGCCGAGATCAGAACCCGAGACAAGATCCAGCCAGCCGCGAGCAAGactgatg
aagatgaagcgggATCAGAGCCAGATCGGAAGTGAGCTCGTGCGGAAGCCGCGTTTACGGCCTTGAAGTCCAAGATCGCGACAACCCCGATCATCAAGCA
CTTCGATCCGGAGAAGCAACCAGTGATGATCGTATATGCAAGTGAGTGAGCCATCTCGGCCTCCGTGGTACAGGATCACGAAGGCACGTACTATCCTGTT
ACGTTTACGAGCCGGACTTTGAAGCAGAACGAGCCGAGCTATGGCGTGGTGGAAAAGGAAGTGCTGGCTATATTGCGTATGCTGGATGTCGGCTACTCGA
TGCTCGCGGGCAAGTCGATCAAGATCCTGACTCGACACTCGACGTTGGCGTGGCTGCTTCGATCGTCAGGGCTTCAAGGACGTTTAGGCCAGTGGGCTGC
GCTTCTTTCGCCATGGACGATGGAGATTGTGAAATATTCGAAGGGTGAAGGCGATCTGCTGGGGGCGATTGCTGCGAGTGTTACTCCAAGATCCAAGGTG
GACGAAGCACTGGTTGCGATAGCACCCAGGAAGGAACCACGTCGAGTTGTGGAGACGCTGATCCCAACCGTCCAACCAGATGAGGGTCTGCTGGTAGCCA
GTTTCGACGGATCCGCAAGAGTCAAGAGAGGCGGAGGTGCGTACAGTGCGATCATATGGAAGTTGCCGGAGTGGACCGTGATCAAGGCTGCATCAGTATA
TGCCGAAGATCTGACGGTCAACGAAGCAGAGTACAGTGGACTCCTGTTATGTttcgacttgctgaaggATATGTCCAAGGAGCGTCTGATCGTATGTGGA
GACTCAAACCTGGTGATCAAGCAAATGTGTGGAGAGATCGACTGCAAGGCTCCAgcgttggtgttgctacGGCAAAAGGCGCTGAAGCGACTCAGGATCT
GGTCTGAACACGATCTTGTGCATGTGAGACGGGCGTGGAATGCAAGTGCAGACAGTCTGGCGAGCGCAGCACTCCAGCGGGAACAAGGTGTAGTCGTCGA
TGTGGCCGCTGATCATGCGGATCTGACCACATTGAACAGGTTGGATGAGATCCTCGTCCCGGTTACCGAAGGTCCAGTGGTTCGAATATCTGCGGTGACT
CGATCGCGTTCAAGGATCACACGGGATCCAAGGGTGCTAGAGGAGGACATTGTGCGACGGATCCGAGTTGATCGGATCCGACAAGCTCAGGACGAAGAAG
TCTGGATCGCGAATCTCAAGAAGTACTTGCAAGGTGACGTCCAGGACCTAACCAAGGATGAAGCCAAGGCTTGCGGAAACATCGCTGCGGACTACGAAGT
GGACGACACAAACATGCTGTTTTACTGCCCGCCAACAAAGTATGCCGATGCTGACTGAGACGGACTCCTACGACTTGTTGCGCCTGAGACGATACATGAA
GATCTGCTGCATCACTATCACGTCAGTCTCGAAGGAGGTCACCAAGGTGTTGGCCGTACCTACCTGAAGATCCGGACTCACTTTCATTGGTGAGGTCTGT
TCGAAATGTGCAGACATACGTCGGCAAATGCGTTGATTGTGAAACAGGTAAGGGGCGACCAACCATCCGTGGCGAGTCCCCTGGCAACATCCAGGCGACT
TATCCGTTTCAGACCCTGGCAATGGATCATATTCCGTCGCTGCCCAAGTCTCATAAAGGGAACAAGGAACTGCTGATCTGGGTGGATCTATTCACTGGTT
ACGTGATCGCGAAAGCCAGTGCCTCGAGAACAGCCCAGACGATCGCGTGTTCCGCCGGTTCGGTGCAAGCGAAGTGATTCGACATGATCGGGAACCAGGT
TTCATGTCGGATTTCTTCCGTGCGTTCAACAAGATCCTGGGACAGCGACAGAGAGCAACGCTGGCGTACCGACCCCAAGCGAATGGAACAGCAGAGCGTA
TGGTACAGACCCTGACAACGTCGTTAAAGATGTACGTGCAAGACGTCGACCAACGTGACTGGGACGAGTATGCAGAACGCCTAAGCTTCGCGATCAACAC
GGCTCACGATAGGATCCGACGTGACACACCTTTCTACCTTGTGTATGGCTGGGATCCAAGAACAACACTCCCTATGGGTAGTACACGCCGTCAGGATCGG
GATCCCCGACATTGGAGATATAGGATCTAGCGTTTTTACCAGCAAGCGAGGGAAGAAGTGAACCTACGGCTGCGTAAGGCGATTACAGATCGAGCCGATC
AGCACAATGAAGAAGTACGCCCGCATCCGATCGAAGCTGGATCCCGAGTGTGGTTATTCTTGGATCGTGTGAAGGAGGGCtacgcgaagaagctcaccCA
TATGTGGCATGGACCGTTCCGTGTCGCTGAGATGATCGACGAATACGCGGCGCCACTGGATATTGCAGGTTCTAAATACCGTCTCTTCCCCGTCGTACAt
gtgttgcagttgaagccTGTCAGATCCCATCCTGACCGCCCACAGAGTCGGTTGACCGTGGATGAAGCGGATCGCCTAGATCTGGACGAGGCCTTGCTGC
CGAAGACAGTTGGATCCGAGAGCTGGCTGGCGACGAGtacgaagtggagaagatctCGGACATGCGGACCGGTCGACGAACGCGCTACGATAGAATACTG
CGCGAATTCTTGGTTCATTGGCGAGGTTACGAAGAGCCAATCTGGGTGACGAGGCAGATCTGAACTGTGGCACGTTACTCTATGAGTTCTTGCGGGATCG
AGCGAGCCAAAACCGGTTCAGCGCGATGCAGTCGCACGAAGAAGCCTAAGTGTGATGGACCAGCAGTGGCGGATTGGTCGCCGCTGTGGTGTGATGATAG
AAGGGTCTGCGGAACGGCCGCAAAGACAGGAGGAAAG