Description :
From Genome Similarity Track
Location :
Scaffold_42:51365- 56343
Transcript NameFunction/comments
Phyag_g1055hypothetical protein PHYSODRAFT_477507
Phyag_g1056conserved hypothetical protein

Sequence
4978 bases(100 bases per row)
CCCGTTTTTTCGGGTAGAATCGCGTGAGCCATTGATTGAGTTCCCTCCACATCCATTATTGAGGAAGTGAGTGAGCATGGCGCCGAAAaaggggaagaag
aacgccaagaagaacgcagGCGCGGCCGCCGCGTCGGACGACCTCGACGACCTGTTGAACGAGTTCGCGCCCACTGAAACCACCGTCGCCAagccggagc
agcagcagctgcaggagaagccGCAGGAACAGGACAAGTcggacgtggacgccgccgccgccgcgtaCTTGGCGTCTCTGGGCGTGGCCCCCGCGGGCGC
TGGaggcgacaagaaggacgacaagaagaagaagaaaaagggcaagaagaaacccaatgacgccaagaaggaggacgacaagaagcccaCGTCCGCTGCG
GCCAAAGCGCTGATGGAGCGGCAGGCGGCCATGAAGGCGGAGCAGGAGCGCCTCGAGCAGGAGCGCCTCGAGCAGGAGCGCCTCgcacaggaggaggagg
ccaagcgaCTGGCCGAGATCGAgcgcgaggaggagatccggcgcaagaagaaggaggcgcgTGCGGCCAAGATCGAGCGCCAGAAGAAGGAGGGAACGTA
CATGACCAAGGCTCAGAAACAGAAGGCAGCCAAGGCTCAGGCGGCTCTTGAGGCTATGCAGCAGGCGGGTCTTGTGCCTGATGCGGCAccagagaagaag
aaggtggtgtaCTCggacaacaagaagaagaacaagaagaacaacaacaagaaggaggaggtcaagaaggaggaggtcaATGTTGTTGTtaaggaggaag
aagaggaagaggcggATGATTGGGAAGCGGCGGAGGATGCTGCGAATGcaaaagaagaggaggaggaagctccCGATGCTTgggacgacgaggactggGA
GACCAGTGACGTCGTGGCATCGCTTGAGGATAAGCTGCAGGAAGTGAaggaagaggctgctgctgctgacagtgacagcgaaggagacgaagacctgctg
gtgctggagcagaagaaggagcaggagcgccTGCGTCAGCAGGGTATTGCACTCAAGAAGCGtcaggaggagcaggccgAACAGATGCGTcaggaagctg
aagaggagcGTCAACGCTCGAAGGCTAAACTTGAAGccgagcgcaagaagaaggaggctgcTGAGCGTCGTCGCGAGCGTGAGGCTGCCGCGCGTGCCAA
TGTGTCCTTGGACAACCTGCGTTCGCCCATTTGCTGTATCATGGGACACGTCGATACAGGTAAGACGAAGCTTCTTGATAACATCCGTAAGACCAAGGTG
CAGGATGCCGAAGCTGGTGGTATTACCCAGCAGATTGGTGCGACGTTCTTCCCTGTCGAGGCAatcaagcagaagacggcgcGTCTTGCTGAGACTATGA
ACCTGGAGTACCGCCTGCCTGGTCTGCTTGTGATCGATACGCCCGGTCACGAGTCCTTCACGAACCTGCGTACGCGTGGTTCGTCGCTGTGTGATATCGC
TatcttggtggtggataTTATGCACGGTCTAGAACCGCAGACTCTGGAATcactgcgtctgctgcgccAGAAGAAGGCTCCGTTCGTTGTGGCGCTAAAC
AAGATCGATCGTTGTTACGGCTGGAAGACTCTGCCTGACATGCCCGTCCaggaggcgctcaagctcCAGAATGAGCACGTTAACCGCGAGTTCGAGGACC
GTATGAAGGCTATTATCGTGGAATTTGCTGAGCAGGGGCTGAATGCCGAAGTGTACTGGCGTAACAAGGATCTGGCCCGTACGGTTTCGCTCATTCCTAC
CAGCGCTATCTCGGGTGAAGGTGTTCCGGATCTGCTGATGATGCTGACGCGATTGACTCAGGAGCGTATGGCTAAGTCGCTGGCGTTCGTTGACATCTTG
CAGTGTACCGTGCTTGAAGTGAAGGTCATTGAAGGTCTCGGTACGACGATTGATACAATTTTGGTGAATGGTACACTGGAAGAAGGAGCTACTATTGTAG
TGTGTACGCTGGACGGGCCTGTGGTGACAACCATCCGTTCATTGCTGACCCCACACCCCATGAAGGAAATCCGTGTTAAGGGCGAGtacctccaccacca
gaagatgaaggctgCTATGGGTGTGAAGATTTGCGCGCAGGGTCTTGAGAAGGCCGTTGCTGGTACGCAAATTTACGTTGTTGGAcccgacgacgatgtt
gacgagctcaaggactCCGTCATGTCCGATCTAACGGGCATTTTGGATTCGGTGAAGGCTACCCGCCGCGGTGTGATGGTTCAGGCATCCACGCTGGGTG
CATTGGAGGCGCTTCTGGAGTTCTTGCGTACGTGCGATCCTCCTATCCCAGTGTCCTGCGTCAATATTGGCCCCGTGCACAAGAAGGACGTTATGCGTGC
CTCAGTGCAACTGGAGCACCAGCCCGAGTTCGCCACCATTCTGGCGTTCGACGTGAAAGTGCACAGCGACGCTACTGAGCTGGCTGCGGAGCTCGGTGTG
CGCATTTTCACGGCTGACATCATTTATCACCTGTTCGATCAGTTCACGGCGTACATGGAGAACTTCCGTATGGCCCGTCGTGAGGAATTCGAGGAGGTTG
CCGTGTTCCCGTGCGTGTTGAAGATTTTGCCCAACTGCGTgttcaacaagaaggacccGATCATTCTTGGTGTTGACGTTGAGGAGGGTATCCTCAAGGT
CGGTACTCCTCTCGTGGTACCGTCTGCTGGAGGCTTTTTGGTCGGCAAGGTGGGTTCCATTGAGCGCGAGCACAAGGAGGTGGATCGCGCCAAGAAGGGT
GCGTCCGTGGCTGTGCGGATAGACAACGAGGGCAGCGTCATGTACGGTCGCCACTTCGACCACAAAAACAAGCTGGTGTCGCGTTTGACCCGTCAAAGCA
TCGACGCGCTGAAGGAGAATTTCCGGGAAGACCTGCAAAAGGAGGACTGGCAGCTCGTcatcaagctcaagaaggtgTTCGATATCATTTAGAGCCATCA
TTTAGAGCGCGCGTGTTACGCGCAGGGAAAGCAGCAGGGAACGTTCGCGCCTGCTCCCTATGCTTGTCAAGAGGAGCAGGCAAGTCCCTGGTTGAGATCA
GAGTACGTTCTAGCGGTGACAGTTATGTTCTAGCAATACATGGTTTTCGCGAATCTCTTTCGTCGACATGCAGGAGCTACCGGATGGGGTTCAGCGCAGT
GGTGGCTTCGTGGCCTGGCCATCGATCTTGGTCGCTGAGCTGTATTTCAAATAGGTGAGATCTTGCCAGCCCTACCACACCAAAAGCAGCTCCACTGCCT
CCATGGCCGTGCTTCTGAATAGCCGCGGGTCTGAACGGTGCATGTTACCAATAGCTCTCGGTGTCGGCACCATCAGCTGCATCCTTTGGGGTGCCGGCGA
CTGCGGATTTTCTGTCTGAGTCCAGGCTCGCTGTCCACGACAACGACCTAGGTTCAGCCGTTCCTGCTTGGTATAGATCCGCGTAAAGCTACCGATGCGA
ATGAGCATCGCGACATTGTGCGTGTAGATCAGTTGCAGCAAAGCCCCTATACCAGTGCTGGTTTACCGTGTACCATGTAACGACTGAGTCTCAAGTCGAA
GAGGTTGTAAAGCCAAACGTATCCTCTCGCGATGACGAGCCCGAGTCCAGGCAGTTGCAAGTCTATCGTGGTGCGCcgtcttgaagttgaccAGCTGGAG
GATTTGCTGGCCAGCGCGAGACGAATGTGTCCAGGAGCGACAGCCCAAAGTTTGACATGCGCCAGGCCCGAACAAGCGAGAAGAGGTCCGGCGGCACTGG
CCCCACGCGCGAAGCAACACTGCAACATGGGAATGTCGCCCAGCGTGTATGTGTGGGTGCATGGGGCCACGTTGGTCGGCGCTTCTGGTGGTAGCAGCCA
GTCGAGACGTGGTTCActgaaaagcagcaaaacggCGCATGAAGCTAGCGCGCGCGCCCGTACATgcctcacttcgcaattGGATCTCgtccgagcagct
ccgttCATCGTCCTCGAGTCTTCGTTCCCTACGTCATGATGCACCGAATGCGGATTCCTCCcatgcaacagcagctcagccacgAGCGAACTACTCCAGG
AGCAATAGCCTCCGCCTCAAAGTCGAGTTCTCTTCGTGCGATGCGAGTGCCCAAGTTCCTACGGAGTCTGTACGACATTCTCCACTTCGAGGATCAGTCG
ATCCTGTCGTGGTCCAAGGACGGCACGTACTTCCAGATCTTCGACACCAAGCGCCTGGAGATCTCGGTGTTGCCAAAATACTTCAAGCACGGCAAGTTCg
cgagcttccagcgccaacttaACAACTTTGGCTTCCGCAAATGGACCAAGACGCAATCTAGTGTCTGCACCTtcagccaccaccacctcgttcGCTGCCA
CCCGCAGCAGCTGGCCGAATTCATCAGTCGACGTCCACCTGCCAACGGTGTGCGATCGGTagtcgacgctgcttctACCACTGCCGTTGCCAAACGCAAA
CGAACTTTCACAGAGCTGATGCGATCTGCTGATGCTGGGGCTTCCGCTGCCGCAAAGACGATCAAGATTGAGAATGGTGACTTTATGCGGTCGGAAGGCA
ATaacttggccatctcgaCAACTGCGGCTCCTGCCAAGTACGCCCCGCGATGGGTGACAGATCCGGTGGGTTTCTTGAAAGCTAGCGAGGGGGTCAGCTT
GACACCCACCAGTGCTTCGTCGGAGCAGGCTTTCAATTTCacagtggaggagctgcacgacatcATTCTTCCGGCCGCACCAATGTCGGACCGTCACGAC
AGCAAAATGCTGGAGTTGCGGATGCTAAACGAGTGCTTAGATCTTGGAACGGCTTCGAACTacgctggtggagaacttTTCCCGTCAGTCCCGTACGCTT
GGGATAGCGACACATTTTTTGCTCCAGTCGGCCGATCGCATTTTGAGCAGGAGCGCGGTCCATGGAGATTGCACTAGG