Description :
From Genome Similarity Track
Location :
Scaffold_161:51364- 52600
Transcript NameFunction/comments
Phyke_g5633hypothetical protein

Sequence
1236 bases(100 bases per row)
GACAACGAGCCACTACGCCAGGGAAGTAGCCATCTTTCCCTTTGCGTTTAGCTTCAACCTCTTGACCTTGTCTGAATTTGGTCTTTGGCTGAGATGATGA
GTCCTCACTGGTAGTCGAAACTGCACCAGGCCTTTTTGGTTGGGGTCTCTTGGAATGGGCCACTTCGTCCTCGCTTTGAACCGCAGGCTTTGTTTTCACA
GGCGAACTGCTAGACCTTGGACGAATGCTCTTCCCCGGAATGCGATTCTCAAGCTCACCGGTTTCTAACTCCAAGTCGCAACTTCCATCAGTATGTGTTC
GGAATACAGCGCATTTGACGTAATTTGTGTTCCCATGTATTTTGGCCTCCACTTTTTGTCCCTTTGTCCACGCCACTTCAGAACTGGAGACGGCATCTTC
TTTCGGAGTGGGGCTTTTCGGCTTACTCTTTGACTTCAGCTGCTTGATATACTTCGCGCGAACACGTAACTCAACTTCACCATCATCATATTCGATGTCG
TACAAACCGCCAGCGCAGTACTTTTTTACTGTACCAGCAAAAAAACGATCACTTCCTCGGAATCGAGCTTCGATTCGATCGCCAGGCTCATAGCGCAGAT
CTCCATCCTCAGCCGAGTCCTTTGGTTTTGGGgctttcttctcctctttttcttcgtcggaCACATTCCTTGCTCTGATAACACGTGCTCGAGAGATTTC
GAGTATACAATCTCCCTCGACGTTCTTCTCATATAACCCGCTATCGAACTCAATGTCATACGTCCCGTTTGGCCGGACGCGAGCAATCACACCGATTTCA
TAATCTCGTTCCCCAAGAGGGATAGCTTGGATCTCCTCGCCACGTTGAAACTGGGGCTTTTTCGGTCGACTAGGTCGCGTGGCGCGTGATCGTTTTTCTG
ATTttcgtctgctgctcctACGAGACCGACCTTGATCagatgagctggatgaagatgacgaggatgacggGCTAGATGACGAGCTGGAATAATAGCGCTT
TCCTTTAGATCTGCGCTTTTTCGTCGACTTCGCatgcttcttgttgctcgCATTTAGCGGCCGCCCACACATCTCGCACTCTTCCATATCGTAATTGTTG
TCGAACTTGCAATGCAAACACTTGATGTATCCTTCACCACGCAGCCCAGGTCGTGGCTTTGAAGTCTCACAGATCTCGCAGTGAGTAGCCCAGTCAGCAA
TCTGCTGGTGCGAACATACCCGACAGACCCAACCAA