Description :
From Genome Similarity Track
Location :
Scaffold_33:513574- 516528
Transcript NameFunction/comments
Physo_134736pol protein

Sequence
2954 bases(100 bases per row)
AAAAGAGTTGAATTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGAAGGCGCTGAATGCGCGGAGCGGATCGGCGATCCTGAAGGACCCG
TCGGATCCCTTGTATCAAGTGGTAAAGGATTGCCAGGACGTGGTTTCGAAGGCGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGTTCGACACGAAATCG
ATCTCGTTCCGGGAACGAACTACTGCGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAGCACGAGGC
GGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCAGACATTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTACCGTGCATGCTTTCAACAAGCTG
AATGCTGCTACCATTCCGGCGCAGACGCCGATTCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATGCACGATGTACAGTGCGCTCGACTTGGTCG
ATGGATATTACCAATTGCTCATGAGGACGAGCGACATTCCTCTCACTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGAGTGGTTGGTGATGCCCCAAGG
GCTTTCGAACGCGCCAGCGACGTTTAATCGTCTTGTGACGCAGCTCTTCAGGTCCCATCGGGCGTACGCCCAAACGTACTTTGATGACATCTTTGTCCAC
AGTCGTGCGGAGCACGGAAAGACTGATATGGAGAACCATGTGGAGCACCTATGTGCTGTGCTCGAATGCATGCGTCAAAACAAGTTGTACGCCAACATTG
ACAAGTGCATCATCGGAGCGGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGATCCGGTCAAGGTCAAGGCCATTATTGA
CTGGCCGGTTCCCAAGAACCAGAAGGATCTTCGCAAGTGGCTTGGCTTAGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGACCA
CTCTCCAATCTCCTGAAGAAGGGTGCGCAGTGGTGTTGGGACACCGAGCATCAAAATGCGTCTGCAGCAATTAAGGACAGTCTCCTTCATGCGCCTATTC
TGGCTCTGCCAGACCCCGCTCGTCCGTTTAGTGTCGTCTGTGACGCCTCAGACTTTGCCATCGACTGTGCCCTGCTGCAAGCAGACGCCGAGAGGCGCGA
GCGCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGGCTGCGGAGAAGAACTATCCTGTCCACGACAAGGAGCTACTTGCAATGAAGTATGCGCTCGTCAAG
TTCAGGGTGCACCTGTTGGGCTCTCAGCCGTTCGTGATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCATCTCTCGCAAAAGATGG
CCCGCTGGCTGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAAGCACAAACCTGGCAAGCAGAATGTCCTTGTGGACGCGCTGTCGCGCAGGCCGGATTA
TGAGCTGGCTCATGTAACGACCGTGACATCGTCATTAACGGATCTGATCCGAACGGCTTATGCCAAGGACGACACTTGTGTCGCGTTGCTAAAGGCTCTG
GGGAGCAAGGAGCTTCAAGACGCGGACACGGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGTTATTTCCTCGATGGAGGCCTGTTGTTCTACAACA
CTTGCCCCGAGGATACGCCCCGCGTGGTCATCCCTCATGATGAGGATCTGAAGTACCGCATCCTCTATAAGGCACATGACACGCCGCTGGCCGGCCATCT
TGGCCGTGAGAAGATCTACAGCTCGGTAAGCACCCACTACTGGTGGCCAAAGCTGTACAAGTGGACGAGCACTTATGTGCGCACGTGCGAGACGTGTCAG
CGAGTGATGTCGTCACCTCATGCTGCAGCGCCGTTGGCGAGTTTGCCTGTGTCTTCGGGCTGTTGGCAATCCATGAGTATGGACTTTGTGTTTGGCCTGC
CGGCGGACGCGGCAGGCAACACTGGAGTCGTGACCTTCGTGGCCCGACTGAGCAAGATGGCTTACATTGCGGCTGAGCCGGACACCATCGATGGTAACGG
TACAGCAACGCTGTTCTTGGACCGTGTGTTTCGACAACATGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACGGGCAACTTCTGGAGC
GCGGTCTTTGCGGTGCTTGGCACAAAGCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGACAGACCGAGCGCGTAAATCGCGTCGTCGAGGACG
TGCTCCGCAGCATTTGCGCCGAGACGCCAATGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGGCTA
CACGCCGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCCGCTGACGCCGACACGTGGTGGCCTCGGGCTTGGTGGGGAAAGAGAAGCCGACTTAGCT
GATCGGCTAGCCGATTTCAGCCCGGCTACGGTTCGTAAACAGGTTGACGCTTTCTTGTCAACGCGTCTCAGTGTCTTACGACATGTGCGTGACGCAATGG
CTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGGGCAGAGGCAATGTTGAAAGTTATGAGGTCGGGGACCTGGTGTTGCTTAATGCTAAGAA
CCTACCTACACATGCAGTATCAGCAGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCAGACCTTTAATGGTTGTGGCCAAGAAGGGCCGTGCGTACACG
TTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACATGGGCTTGCTCAAGCCGTACCAGGACCCGATGCAGGTGCAGATGGAGGCACCGAGGT
TGACGAGGTCACAGGCACGGAGGTCCCAGGCGTCGAGGACGCGACCATCAACGC