Description :
From Genome Similarity Track
Location :
scaffold_8:513570- 516291
Sequence
2721 bases(100 bases per row)
GGAATTCGTCACGAGATCGACATGCTTCCTTGTACCAAGTACTGTATCACACGGTAGTGGCTGTTGCCAAAAGAGCAAGTCCTTGCAATTGAACAAATTC
TTTGCACAGCGACAAAAGGCTGATCATGTGCGTAAGAGAAAATTTCCGCATTGTAGTATAACCTTCTGTGTGAAGAAAGCCGCAGGTGGTTGGCGCATTG
TTCTCGCTTGTAACAAATTGAACGATGCCACCATACCTGCCCAGACTCCGGTTCAACGCAAGGATACGATTCTGGATGGAGTGGTGACAGTACTATTTTC
AGTGCGATCTATCTGAAAAATGGTTTCTATCAGATACGAATGCGCAAAATAATACACCACTAACTGCGGTCTGTATCCCAGTGGTATTCTGTAGGAATTG
TAGTGATGCCACAACTCCAGCGACGTTCAGCAGAATAGCCACGAAGCTTCTTCGGCTATTAGGAGAGCTTGCACCGAGTTACTTTGACGGTGTATTTGTT
CATGGTAAGAAATTGGGTGAGTAGTCTGATGCCGATGTTCAGTttgatcatcttcgtcaagtcTTCCGAGAATAAACTCTATGATTACCTGTataagtgc
attttcttgGCACCTGAGATCTCCGTTCCCGGCTGCTTTGTTGGCAAGAATGACATTCGTGTAGATCCGGAGAAGGTCAAAGCTATTAACGCTTAGCCTG
TGCCAAACAATGTGAAACAGTCGGGACAATGCTTAGGTTTGGACAATTATTTGCACAAACACACGCGCAATTATGCAGCGTTGGTGCAACTCCTAACGAC
ACTTTAGAAAAAGAACGCTTAGTGGGAATGCTTTAAAGATTAACAGGCAGTATTTGTtgaagtgaagaagagctcGATAGAAGCTCCTGTCCTTGCGACT
ACAGACCACGATAAGAATTTTCAAGTGGTCTGCGATGCAAGTGATCATGCCTTTGGTTGTGCTCtgatgcaacacgatgatcAGATCGAGAGTGAGTTGC
TTCGTATCAGTCGCGACAACTCCGGCCCGCAGAACGAAACTATCCATTTTATGACAAAGAACTTCTAGCAAGAAAGTATACATTGATTTAGTTTTGTGTA
CATTTGCTTGGAGAGGAGCGCTTTGCAAttcatacagatcatgcttcGCTGCGTACGGAGGTAAATTATCACAGAGAATGGTACGATAGTTCTTCTGATT
TGCGGAGTACAACTTCGTTGAATATTCAAGCCAGGCAAGACGAACATCTTGGCCGATGCGCTGTCAAGACGTCCGAAGTATGATCAAAAGTCCAGAAGCA
AAAAACATGTACGAGTCATGTCGATAATGTGAAGATGTTCGGGTGATCATAGTGCAAGCAGCGACTACAGTGCGCCCAGAAATTGTTAAAGGGTGCAAGT
CTGATGAGAAATGCCAGGACTTGTTGAGATCTTTCAAGAATTAtccgacaaagcactgcaaggtcTTCGGTCTCGCACAAAATAGCGTGTTTACCGATTA
GGAATACACAATAGATTTTGTACTATGCGAATGGACAAAGGGATACAGCAAGAGTTATTGTTCCTCAGTGACGAGGATTTGCATCATCGTCTCCTATATG
AGTACCATAACAGCCCTTCAGGTGGCCATTTCGGACCTGAGAAAACGTCTCTCAATGATTACTATCAACCGCACACGTATAAGTGATCGTGCGAATATGT
GAGGACTTGTGAGATTTGCCAGAAATTGAAACCATCGGATTCCGCTCATGCCCCACTACAGTCATTTACATTGCTAACTGGCAGCTGAAAGTCTGTAATA
AATATAAGCTTCATATTCGGAAGTTTCCGTGACACACATGAACGCAGTGGCATCGTTGTGTTAGTTGACCGATTCAGTAAGATTGTTCATCTAGCGTCTG
TTTTGGATGAGATCTCTGCTGAGAAAACAGCTAAGGTTTTTGTGGACGTGGTTTTCCGTCTGTATGGCCTATCTATCGAGATCGTGTCTGACTGTGACAA
CATTTTCACGTTGAGGTTTTGGCGTGCACTTGTTTGACTATTGTGCACCAGATTGTTTCTGTCAACAGCAACACACCCTGAAACAGACGGTCAAACGGAG
CGTATGATTCGGGTCCTGGGGGACTAGTTACGCAACGTCGCTCAGTGAGTGGAGTGAATTTCTCCCTCTTGCAGAGTTTGCGTTGAAGAATTGCACGCAT
GCCTCGACAGGTCATTCAACATTCTATGTGAGCTATGGTATTCATCCTAGAGTATCTGCTTCCATAATGGGCGGGGTCTCTACTTTAAGTGTGGGGGGGA
ATGTTGCTACGGAGCCACAGTCAGATCTAAATGCGGTCACAGAGTTAGAAGCGAATTTTGACTCATTGCGACCTCTAGTCGACATAACAAGTCGTGAGGA
ACAGCACGTCGATAACTTTATTCTGACGCGATAAGCCGTTGTGCAATTTGTTCGCGGCGCAATTGGAAAAGCTCAGGAACTGCAAGTAAGCAGATAAAAG
CGgaaggaagaacaagaaggtaTATAAGGTCAATGATTGTGTACTACTTAGCACGACAAATCCGCCTGCAGATGTAGTGTCCAACTTGGGAAGCAGGAAG
CTTAACCAagatttattggaccgttctAGGTGTTGTAAAGAATTTGTGATGCGTGTACATTAGCCATCCCTACATGCATGCGTCTACAACCAACATATAA
TGTGGGTACACAAAAGTTGTA