Description :
From Genome Similarity Track
Location :
scaffold_8:513569- 515709
Sequence
2140 bases(100 bases per row)
AGGAATTCGTCACGAGATCGACATGCTTCCTTGTACCAAGTACTGTATCACACGGTAGTGGCTGTTGCCAAAAGAGCAAGTCCTTGCAATTGAACAAATT
CTTTGCACAGCGACAAAAGGCTGATCATGTGCGTAAGAGAAAATTTCCGCATTGTAGTATAACCTTCTGTGTGAAGAAAGCCGCAGGTGGTTGGCGCATT
GTTCTCGCTTGTAACAAATTGAACGATGCCACCATACCTGCCCAGACTCCGGTTCAACGCAAGGATACGATTCTGGATGGAGTGGTGACAGTACTATTTT
CAGTGCGATCTATCTGAAAAATGGTTTCTATCAGATACGAATGCGCAAAATAATACACCACTAACTGCGGTCTGTATCCCAGTGGTATTCTGTAGGAATT
GTAGTGATGCCACAACTCCAGCGACGTTCAGCAGAATAGCCACGAAGCTTCTTCGGCTATTAGGAGAGCTTGCACCGAGTTACTTTGACGGTGTATTTGT
TCATGGTAAGAAATTGGGTGAGTAGTCTGATGCCGATGTTCAGTttgatcatcttcgtcaagtcTTCCGAGAATAAACTCTATGATTACCTGTataagtg
cattttcttgGCACCTGAGATCTCCGTTCCCGGCTGCTTTGTTGGCAAGAATGACATTCGTGTAGATCCGGAGAAGGTCAAAGCTATTAACGCTTAGCCT
GTGCCAAACAATGTGAAACAGTCGGGACAATGCTTAGGTTTGGACAATTATTTGCACAAACACACGCGCAATTATGCAGCGTTGGTGCAACTCCTAACGA
CACTTTAGAAAAAGAACGCTTAGTGGGAATGCTTTAAAGATTAACAGGCAGTATTTGTtgaagtgaagaagagctcGATAGAAGCTCCTGTCCTTGCGAC
TACAGACCACGATAAGAATTTTCAAGTGGTCTGCGATGCAAGTGATCATGCCTTTGGTTGTGCTCtgatgcaacacgatgatcAGATCGAGAGTGAGTTG
CTTCGTATCAGTCGCGACAACTCCGGCCCGCAGAACGAAACTATCCATTTTATGACAAAGAACTTCTAGCAAGAAAGTATACATTGATTTAGTTTTGTGT
ACATTTGCTTGGAGAGGAGCGCTTTGCAAttcatacagatcatgcttcGCTGCGTACGGAGGTAAATTATCACAGAGAATGGTACGATAGTTCTTCTGAT
TTGCGGAGTACAACTTCGTTGAATATTCAAGCCAGGCAAGACGAACATCTTGGCCGATGCGCTGTCAAGACGTCCGAAGTATGATCAAAAGTCCAGAAGC
AAAAAACATGTACGAGTCATGTCGATAATGTGAAGATGTTCGGGTGATCATAGTGCAAGCAGCGACTACAGTGCGCCCAGAAATTGTTAAAGGGTGCAAG
TCTGATGAGAAATGCCAGGACTTGTTGAGATCTTTCAAGAATTAtccgacaaagcactgcaaggtcTTCGGTCTCGCACAAAATAGCGTGTTTACCGATT
AGGAATACACAATAGATTTTGTACTATGCGAATGGACAAAGGGATACAGCAAGAGTTATTGTTCCTCAGTGACGAGGATTTGCATCATCGTCTCCTATAT
GAGTACCATAACAGCCCTTCAGGTGGCCATTTCGGACCTGAGAAAACGTCTCTCAATGATTACTATCAACCGCACACGTATAAGTGATCGTGCGAATATG
TGAGGACTTGTGAGATTTGCCAGAAATTGAAACCATCGGATTCCGCTCATGCCCCACTACAGTCATTTACATTGCTAACTGGCAGCTGAAAGTCTGTAAT
AAATATAAGCTTCATATTCGGAAGTTTCCGTGACACACATGAACGCAGTGGCATCGTTGTGTTAGTTGACCGATTCAGTAAGATTGTTCATCTAGCGTCT
GTTTTGGATGAGATCTCTGCTGAGAAAACAGCTAAGGTTTTTGTGGACGTGGTTTTCCGTCTGTATGGCCTATCTATCGAGATCGTGTCTGACTGTGACA
ACATTTTCACGTTGAGGTTTTGGCGTGCACTTGTTTGACTATTGTGCACCAGATTGTTTCTGTCAACAGCAACACACCCTGAAACAGACGGTCAAACGGA
GCGTATGATTCGGGTCCTGGGGGACTAGTTACGCAACGTC