Description :
From Genome Similarity Track
Location :
contig_65:51356- 53172
Transcript NameFunction/comments
g9495.t1Argonaute3 (AGO3)

Sequence
1816 bases(100 bases per row)
CACCGTGGCCGCCTGATCGACATTCATCAGCAGTTTACGGTCGGCAATACGAATAGCTTGGTGGTAACCCCAACACAGTTCTTTGCCACCCTTGAGCGGG
AACGTTTTTTTCATGGAGAAAAAGTTGCGGCCCACAGCGATCAAGCGCTGAGCTCCAAGATGACGTGCAGCCACATCCAACGCCTGGAGGACCGGCATAA
CATTCACATCCGGGTTGGAATAGTAATCCGTAAGTGAACTTGTCGAGATCGTCTCGGCGAGCTTGATCTTCACGACAAATGTGCGAGGGCCTCGGAACGG
GCGGCGAGGCGCATCACCTGCAGCTGGTGGCGGAGGAGGCGGAGGGGTCGGACTGGGGCCGTCCGGGTTAACGTCGACGAAAGTCTTGGTTTGCGCTTCC
CACGGTATCATAGCAGGCGCATACATGGCAGACATACCGTCATGCACAACGCGGATGCCACCAAACTCAGTCTCGTATTGACGGAGAGCAGCGTTGATCA
CGTTGCGAACCAGAGCGCGTGGAAGGGGTCGTTCCGGGCGCTGTTCACGTTTAGGAGGTGCAGACACGTCGCTCATTTCCACGTCCTTGTCCTCTTTTTC
GTCTTTACCCTCTTGCTTTGGTTCGTCACCCATGGTCTCATCCTTTTGGTCTCCAGGTGTACCGCCAGAAGGACCGTACTTCGAGTCTGCTGCGAGGTCA
GGCGAGCGCTCGACATCCACGTGGTATTTGAAAATTTCTGCTGGAACCGTGTCGAGCGAGACACCGAAGTAGTTCACACTCAACTGCATCGATTTGCCAC
CTCTGGCGACGCCCGGGCGGCGACAAATAAGAAACTCCTGCTGGAGCTCCGGGTCTTCAGCGCTTACTTCGCGCACGCCCGCGCGACCAGTCCACTCGTC
CTGGAGACGCGGGTCAGCCACGGGATCACCCAAAGTCTCATACCCGGAGCCAGTCACCGTGCCAACACCGGGGCCTGACTCTCCGCGGCCACCGCGACCC
CACCACCTCCAGAGCGACCGCCACCGCGGCCTCCACCGCCGTATCCACGATCTCCTCCACGGTCACCTCCACGGTCACTCCACGGTCACCTCCACGGTCA
CCTCCGCGGTCGCCGCCACTGCTACCACCGTATCCACGATCTCCTCCACGGCGATCACCACCTCCACGATCATCGCGGCGTCCGTAGCCACGATCACCTC
CACGATCTCCACCACCACCATAGCCACGATCGCCGCCACTGCTAGCACCGTATCCACGATCATCACGGCCGCCACCAGCAGCCGCTCCACCACCATATCC
GCGGTCATCCCGGCTGCCATATCCGCGCGAGCGGTCATCATGGCCACCTCCTCCATACCCTCGGGAGCGGTCGTCATGTCCGCCGCCGCCTCCCCCACTG
CCATAGCTTCCACTGCCTCCGCCATAACCACGGTCATCATATCCACTGCGGCTCTGATCATAACCTCCAGAGGACGCAGAGGCTGCATAGCCACCTCGAC
TATCGTAACTTGATGATCCTGCGTATCCCCCAGAAGAGCTGCCGTGCCCTCCACGATCGTCGTACCCCGACCCTCCGTAGCCCCCGCTGCCGTACGATGC
TCCTCGACTGCGGTCATCGTAACCACCACTACCGTAACTCCCACTGCCAGAGCCGTAGTCGCCCCTCTGCTGTCGTACCCCCGAGACCCCGATCCAGAGG
CACCGTAACCCCCTCCGCCGCCGCGACTGTAGTCGTCGTACCCCGACGATCGCGAGCTGTACTCGCCGCCACCGCGGGAGTCGTACCCCCCTCTTTGCTG
CTCGTACCCTCCTCTC