Description :
From Genome Similarity Track
Location :
Scaffold_1322:5135- 6306
Sequence
1171 bases(100 bases per row)
GTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATATAGTACCGCGGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAATACAAACTGCCTA
AGAAGGATTGCATCGCCCGCAGCGACTGTGGGAAGGACAAGTCGGTAAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAGACTCGATG
ACCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACACTGATAGAGAGGTTCCACTTAGTACACGCCTCCAGTAAGGAGGTTACTCTTTCG
CACATCTGATTCCACGATTCCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAAAACAGACGGGGTCCCAGGATCCCCTGGCTCTGCCGCTT
CGAATGATTCCACTTCCGTATGATCTTCCCCGGATCCACCCTTTTCGGGTTCCGGTATCCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTA
GATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATA
GTCACCATCCAGAACTCACTTGCCATATCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCA
TCAATCGAGTCAGGCCGTTAACTAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGA
TGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCTGATAGTTGTTCTCGGAACCGAGGTGCCACCTTCCGCACCCTTTGAGCGATC
GGCTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGCAATGCATTACCTTTACCAATTAGCAGATGTCGGCTTTACCAGATTT
TCTGACGTAACCGATCCACTTCCGCGGGCTCGTTTGCCCCTGGATCCACTTGGATATCGTCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGTAT
TACCGCCAGGCCATCCCCGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGTTCATCTT