Description :
From Genome Similarity Track
Location :
scaffold_65:51347- 55560
Transcript NameFunction/comments
Plaha_PHALS_08120myotubularin-like protein
Plaha_PHALS_08121hypothetical protein

Sequence
4213 bases(100 bases per row)
accaaaggatacacCGGATCCTTGGGGTTCTTGAGGATCTCAGAACCCAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTTACAACAGAATTCAGAGGAATGGAGGAACGACAAGTACGTAAGCGGTTTATTGTTCTGGTGCTGGATCTTTACGACAT
ATTGGGTGATCTGTTCCAAATGAATTCTTCCTATGTAGCCTCCGCCTTTCCAAAANNNNNNNNNNGGATAAAGGAGCTGAACATGCGTAATTCCGAACAG
CGGGATGTATGCTACGCCACCCTGCCCACCGCAACATCGCGACTGAACAGGAACTTCGTCGAACGGTGTAAAGATGACTCTGTAGTTTGTCACGGCGATT
TTTCCGCGGATCCTGCCCCACACCTGAGCGGATTCATATGTCTCACTAGCCGGGCCGATAAGCAATGTTGCTTGTAGCTCCGTGTCTTTGACCACAGCTT
CTCCAGGTAATAGCGGCACGTGAATCGACTGCAACATcggaaagtcagctgtaatGCTACAATTTGTATCATGTGTCAAACTCAATTCTGACTCGACCGT
CGTCGACGCGTTTGCTGAATACGTAGTGTTTGGCTCTGGGGGCGTCGGCGAATGAATGTCGTCTAATGCAGGAGATGCGGGACATTCAGGCCACGCAGGA
AGTGACATTGCATTTCGTGTTGCAAACTCACGTATCCTTTCCAGTGTTGTGGATCGACAACTATCTAAAGCCTGCTTGAATTGCTCTCGTTCATCATCAT
TTGCAAATTTCAGCTTAAGCGATAGATTGCCTTGTCCCCCATTAAATATGATAAGATGTGCCATTCCATCTGAGGTTCCAAAACTAAATGATTGAACAGA
GTCGCAATGAAACGACCAGAAACGATGCAGAAATACGGATTTCGCTCGAACAATTCGTTGGCGACAATCGAACTCTAGCGTGTACCGATCCAGTACCGGA
TTTGCTTTTGCAAATCCAAAAGTCCTGCGCAATCCCGTGCTTTCTTTTCCACCCATTTCGTAGACTGCAAACCGCAATACCGCTGCTGAAAGCTTTGCTT
CGCTTTTCAACTTTACATCTGCAGAATCTAGCTTTGCACGCTCATCTACGATATCACTGTCATCGAAAGCTTTCTGTGACCGCAAACTGTTCGAGCGACC
ACTACCATTGCTACCAACGTCAAGAGCAAACATTTTCCCTTCATCTGAACCAAATGTATTAGAGCGTGCCATTCCTGGTGATTCCAGCGATGAAATAGGC
GATACAGCAGCGTGTAGATTTGTTAGATCAAAACTTGCTGATCTCGAGAATTTGGATCGAGTTTTCCTTTGAGGTCGCGTAGAATTAGTGCATACAGTTT
CCACAACAGGCTTCTCAGAAGTTGTCAATCGTGGTTCCTTGCCCTTAATATGTGAGCTTTGCGAAGCACCTACCACGTATGCTCCATCTTGCAAATCGAT
CGGACTGTTTTCCACTAAATATGTTCGCTGACCACGTGTATCATGTGCAGATTCGTCTATGTATCTGCTTTTGgaagacgtcacactgcttgaGCGAGAT
TGCTGCGACAGCAAATTAGGACTATTATTTACAGTCTCACCCCCTTCGCTATCTCCTCGAGCTCTTCTTTTTCGTGGAAGTCGATCATTCACATGTATTG
CACGCAAGTGACCACTAAACCAAGGTTTGGTCCTGTTTACCGATGGAGATGATGACATGGATGAAAAACGATGACGCCGTTTGAAAGACGTCGTCGAGAC
CGATGTGATGAGCTGATCCTCATTATCGCAACTATCATCCACGATTTCATCGCAAGGTACTGGTGTTGGGGAAGAAACAGAAAACCGACGTCTCGCTACC
AAAGAACCTATTTCTTTAATTGCGCTTGGTGTTGGGTCTATAATGCTGTTACTGGACACTGATGGGCAATTTTCGCGTATCACACTATCGCGGTGGATTG
CAGAGTTATGATCCTGGTCCGTCACCAGCTCCATCGCTTCAAAGTATCGGTCCAATGCATTTTGATACCACCTTGCACACAAATCACAAGTACGCATCAA
TTCTTCCCCATATCCAAAACGCGTTGGTAATACAAAACTCTTCGACGAGCATCTCGGACAAAATGCATACCCACACGATGCACAGCTTTTGCTACGATGA
AATGGATTAAATGACTTGCTGCAGCCACAGCACGTCGAGTTTGTGCGCAAAAGCGCTTGTGGCATCGGCACACCTGGTCCATTACCAGTCGCCAAGGGGT
TTGTTTGCGCTCGCTGTAGCGACACTGACATCAGCTCTTCAAGATTAAATTGCAGGTTTCCCGTCGTCTGACTCGTCTGAAGCGCCTTCTTGATCCGCAA
CTGCTCGACAATGCGCGCAGCTGTTTGCAAAGCTGCGGCGGCGGCCTCTAGCTCGACTTCGTCTAGTGGTTTCTCttcgtcttcgtcttcttcatcctcT
TCTCCagcgtcatcatcatcatcatcgacTGCAGACTGGATCATCAGATTCAAAGAAGAATTTTTGCCCGATGCTTCTGCGCCTGATCGCCTTCCCAGCT
CCTGGAATTCTTCTTGTGTCTTCTCAACCTCTTCATCCTCTTCTTCTATGCTTCCGCGTCTAGCTGCGCTGGCATTTGTTGTGTCTTCTAATATCGAGGT
GGATAGAGCGCGAGCCAGCAGCGCCGCCATGCGTTTCGGGTCGCGCAGCacatccagacgtgctacatcGTCACCCATAGACTTGGCAGACGTCANNNNN
NNNNNTATAATTTTTCTTTGCCAGTCCTGGTGGACGAGGTTCTCACTTTGATTTATAGTCATAAACAATTTGCTCAACTTAAAAGTGAGGTCACTGGTTT
TTTAACAGCAGAAGTTTTGCCGCACACGAAACAAAAAGCAATAGAGCGTCTATTTGGATGTTTCATAACTCAATTCGAAGAATGCATTACTGCTGTTGGC
TACGCGAACAAAATGCCAGAACTGGCTTTCCAAAGGACTGATGGAAGAAGCGCGCGCTATAGTGCATGGAACCGAACATGGTTGCTAGCCCCCGAATCGA
TCCAAATTCTCAACATCATGGATGGGCATGAAATTTCTTCCGAGCTTTCACTGGTAGACTTTTCACGGTGGATATACGAGTTATCGTGCATTAAAGTGAC
AACTAATGGCGTACAATTGATTGTGCGCTCCGTGCTTCCAATTATAAATGGTATGGCAGCAACAGAGCTCGTTCTGGATGGCCATCTGCAACATCTTCGA
TTGACACCGGGTGGAATATCCATAAAACTACCAATTTTAAAGGAGTGGTGGGTAAGGGACTATGCAGGGAGGTTTGCAGATCAATTCAGCACGTTCAAGC
TTGATTTCTATGCTTTCAAAGCCAAACAAAGCATTGATGATCAGACCCGTTCCACTGGAAAGAAGGAGAACAGTACGACTGTNNNNNNNNNNAGTAATTT
TTCTTTGCCAGTCCTGGTGGACGAGGTTCTCAGTTTAATTTATAGTCATAAACAATTTGATCGACTTAAAAGTGAGGTCACTGGTTTTTTAACAGCAGAA
GTTTTGCCGCACACGAAACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNN