Description :
From Genome Similarity Track
Location :
Scaffold_136:5134- 6769
Sequence
1635 bases(100 bases per row)
TGTGCTGTTTCGGAGGCGCCAGAGGAGCACCGGTGTCACCGTCTACCAGATCATCCAAATTGTCGCCATGGCTTCATTGGGGTGTGCCGTCCAGCGCGCT
GTGCATGCTGGTCCCTCGCCATGAAGTCCACTATTGGAGGCGGAGCTTGACGTGCAGCTACTGCCTTCTGAAGAGAGTCTCGCTCGCTGGGTGTACTCGA
GTGACCGAGCCAAGTGTCGAGCCATCGTTTCCACGAGAGTTGGGCTTTTGCGCAAGACCAAATGATGTGGTCAATGGTTTCCTTCTCAAGCTTGCACGAC
ATTTCAGGACATTGGGGCCAGTTGTCGTGGTAAAGCCTAAGGGTTCCTAGCGTGATCCTGTAGATCGTCCAAGCTTCATAATCCGTAAAGATGCCTCGTT
GTTGCCATATTCTCCGTGGACTTTGAGTCAGAGCTGCCTACCCCATGATGATGATCATTTACGGTGGTTCACCTTAGCCGTGATATCCTTCCAGCTGTAG
TGATGGTCGCGTTTAAAAAGTCTGGATCGCTACCGGCGGAGGTTTTTGCAAAGGGAATGCGTACCTACCTCCGTCGATAGGGCCCAGGGGTAGATGGCCG
TTTGTGGGGTTGCTGTGAAAGCAATGCCCGTCCAGTTGGCCCATTCCGCAATCTGCGTAAAAACTTCGGTCTGACGGTACTCTGGAGATACGTGGGCGAG
TCTCCATGATAAACCGTCTGACTTTCTCATGACCATAAAGGCTGATTCTGTTGTCCTAATTAACTTCGCCTTCATTGATCGGCGTGCGCTGTTGTAGGTC
CACGTGATCCTCCGCTGACCAACCGACATCCCGATAAGCTGAGTGATGCTGACTATGGAAGTCCATACGGTCCACGGTAAGCTGAGCATGATGTTGCGGC
ACCACCGTGTTGTTTGCCGTAAATTTGCTTTGCACTCCTTGCCTCGTGTGCATGGCGGACGAATTATGGTTGCGTGTTCTCCTGCAGTGGTCAATCCCGC
TTCCGGCTGCACGTGTAGGTCCTTCAGTCGGGCTGATTGAAATGCAGGGAAGTCACTGAGTCTGAGTGGATCTTCGTGATCATCGAAAATACATCCGTTG
TCGTGCCATGCCGCGTTCTACAGGAAAGCCAAGGTGACCTTGGGGAGTTCGCGTGTTGGGGTAGACTGAGTCGTGAATCGAACCCCCGAATCGTCTGTCG
CGTAGCAGTAACTTAAGGCTGGTCCCGCGATGATGGCCATTTGAATCTCTAGTCGTTGCTGATCAGTGGGTAGCGAACCTTTTGAGTACGCTGCCCAAAG
TTCAGCCGTTCCCATTGATGGTACGTTGGCTTGGGGCACTTCTCGCTTCTCTTTTTGCATCTTGTGGAGCATGTCCTTCGATGTTGGTCGGAACACGCAA
CCAGACGAGTAACATTGACCGTTCGGGTGACATGCTGCGTGCCAGGCTGCAGTATACGCATCATCTTCACGTTGGAGCCATTTGTCCGCCAGATTGCACC
GTGTTGCCGGTAGAGCTAGTCCGATATCTTGTAGCCCGAGCCCACCGTCTTCTTTTGGTGTGAATACGAGTGCTGGGTTAAGTTGATGTCGAGTTGGTTC
CGTGGTAGTCTTACTGTTCCACACAAACTGTTTCT