Description :
From Genome Similarity Track
Location :
Scaffold_781:5134- 6705
Sequence
1571 bases(100 bases per row)
CCCCCGCCGAGTATCCTCTTTGACTACCAAGCGACTTCAAATACCACAACTCCTTTGCTTTCCTGCTGTCATCACTACTTTTCTTGATGAAAATCAAAGC
ACAGAGCTGAACAGATGCGATTGCTAAACTATCAAACGCTCATCAACTAAGTTTGAGTTTCTAATAATCCTTTTTACGTATACTTGGGGCTTAACTGTTT
GGCAACTGAGTGGAAGGTGATGAAAGCAGCCGAGATGTCGACATCAGTTCTAACAAATCTATTTTATAAGCGAAGTCACGATGTTAAAGCGAATAGGGAC
CAGTGTCTTCGGTAAGTGTAATGATTCATCGTTTGCGCCCCCAAAAATCGCGCAGTATAAAATAGTACTGTTTAggtataccggtattataGTAGCAGTA
AAGAAAAATATTCAAAAACTACCGTGTACGATAGTAACAATAGTACTATTTACTATTTTCTACTATGATAGAGAGGGGGTACTGGTTGTGGCCCACGACC
ACTATAATTTTGTACAGGTCGAATCTGGCTTGAAATGTTACGTAAAAGAGTCATCCACAATGAACGCCTTTGAAAACCATTACATTTCCGAATATGTAGA
AAAAAAATAAGGGACAACCATTCTGCAAAGTAAATTTTAAGTCGAAACATAAGCGAGAAATTGGCTTAGAAACCGTCCGAATGGATGTGCCTCGCTCTAG
AAATTAACTACGATTCTGCATGTGACACAAAGCCTGGGACGAAGCACTGCCGCAATCTTGGTGACGATCTTCTCTCCCCGAACACGGAGGAGTCCGGTGT
TTTCGCGCTAATCGTGTTGCTTCGGCGGCGTCGACGAGTCCCTCAAATCCACGACCTCACTAGACAAGTCCACGAAGCTATGCTTCGAGTTGACCTGTTA
ACAGTCGCAGCCATCAGTTTTCTCGCCCTCGTAGCTACTATAcggcaagatgctgcagagcaAGTTGGTGCGCAGGAAACCTGCTCAGTCTTGATTCCTT
CAGGCTGAGCGGCCCATTTGCTTCATCCTGCGCCACCGTGAGTTAGATGAACGCCTATGTAGTAGAAGAATATAGGATCAAAATACCGAGTAGCTACTTC
TCAAGAAAAGGCAGGATTAATATTAATCAACAATATTTCACCATACGCAGCATTGTGATAAAACGATGGACAGAACTAAGAAGCTGGCTGGTCGATGGGT
GAAGTATCCGGGATGTGGATGCTGCTATTTCCGGAAGCAGGAGGATTCGAGGACGTTCCAAGATGCGACGATGTTGTGCAAAGCAGCGCAGCGGTAGATC
ACGGTAGTGCTAGCTAGGCCGAGAAGGCGTCAAGTTCATTCCAGTTTCCTCTCCGCTACAAGAAATTCGAAAAACTAATGTcgtgcgttgcccgggaagc
tctggatatcagtacactaactggaACTACAGCAATTGTGGCGTTCCAACAATGAACTCGAGTTTAGCAGCAAAATAGGTGGGGCTGAATCGGATGTAGA
GGGAGTCGAATGCCGTGGTACTCTTAATCGATTCCCCAGCTGTAACTAATTGATCTCTACGTCGAGTAtta