Description :
From Genome Similarity Track
Location :
contig_120:51322- 52773
Transcript NameFunction/comments
g11376.t1hypothetical protein PHYSODRAFT_304265

Sequence
1451 bases(100 bases per row)
TGCTGGCGCGCGAGCTCTTGCAATGTTGCCACATCGGTAGGCGTGAGACTCTGCAGAATAAATTTGACTCCACTACTCGTGGGATCTGCCGTCTTCGCAC
GCTTAGCTAGCCGCAACTCAATTTCATCTGTGTATGGTTCACAGGTATCAAGGTTCTGACTGAGCCATTCAAACCGCAGCGAGTCTTCCTCCTTCCAAAT
GGAGGGGCCGTTGACGTGATCCATTGAAGCCACAAGAGCGATGAAAGGCGACTTCGCAAGCCAGCTCAGACACGTCTGAGCCTCTGGGTTACGTAGCGCC
AGACCGTCAATCGAATGCACCAGCAGGTACACTTGAGGCGCATGCCTTGCCATTGACTTGGTTCTAGCAATGTCACGACACTAAATAAACATGATAAATG
CTGCAACTTCTACAATTCCAATAAAGAGGGGGGAGGTTGGTTACCTGTTGGGAAAGTGATTGGTTTGGCTTCACGTCGATGCTCAATATCTGTACAACAA
GATAAGGAGACGTAAGTTCGCGTTAACCTCTCCAACTCCAGCTATGCTATTACTGATTCACCTTCTGCTGGATGGTCTCAGCCAGATACTTAAGCGAGAC
AACAGGCAGATAACCATGCACCTGCATCACAACACCGTCGCTCAAATGCGTCGACGCGAACTCCTGCAGATAACTAAAGTGAGTCTTCTGTGCATGCCCT
AGCAAGACACACACCGCTCACTTGAAGCAGCGACAGCTTGGAGCCCACGCCGTAGAAGAGCAGGTTGTAGCCGGCCAGCAGCTCGCTCTTCCACGTCGGG
AAGTGCTGCGTGAAACCTCCAAGCGCTGTCTCCACGTGCTCGTCCGCAGCTCGCAGCTCCGCCAGCAGCTGCCCGCGTGACGGCAAGTGTAGCGCCCCCT
CGTCATGGTGGTCTTCGTCCTCCTGTTCCTGGTGACGCCGCGCCCGTTGCTCCTTCAGAGGCAGCGGCTTGGGCTTGCGAGGCACGCGCTGGCGGAGGCG
CTTGGATGTGAAGTACGCGTTGGCTGAGGACGCGCCAAGCTCGACGCTGTCGCTGGGCGCCGTGCGCCTCTGCCGGAACCGCGCGCGCAGCCCGTCGCTC
ATGGCTGGCACAAAACCCAAATATTCCGTACGTAGGATTCGCACGGCATTTTTCATTTTCGCATAATAATGCCTCCTCGTTGTCTCCGCGGAGGACGGCG
CTTGCGCGACGCTGGAGCTTGGAGACTGGACGAGTGCGCTTGACGGAGGAGTTTCTGGCGACGGAGCTCCGGCAAACGGCCGACGTGCTCAAACAAGTCG
GCGTGCTCGGCTGGAAGATCGCTGGCCTGCACATTCTGCGTTGCCTGAAGGAGAGCACCTCGGTGCCAACTTCTTCTATCGGTGCTGCAGTGCATCGCTC
GCGCAGACGGAAAAACGAGGCAAGGAAACACCAAAACACCCGGATCTTCAC