Description :
From Genome Similarity Track
Location :
Scaffold_542:5132- 6364
Transcript NameFunction/comments
Phyca_LT1534133537Hypothetical protein

Sequence
1232 bases(100 bases per row)
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncctgt
tggtgtgcatagctttaaatgccggacttgttggtaatgtatcccgaacaaactgcacaagcgatgtgttcgcgtcactagcgctgatctgcgtttgccg
aagtgcatcatttgcctcttcgtctgagtacatagccatttgagtcaacgaagctttgaaatgagtggctacatcagaggcgattcgcaaaacggaggct
cggagtgacatgggtacaattgaggcgatcttacaacccatgcactcggttatcgctgacgaacgagtcacgacttgctcaatgttattcgttcgagttg
cgaatccaagtgcggttacctctgcgacgaacgctgcctccaccaactcatctcgatgctttgtaaaggcggtgagctcttcttgagttgactggtccat
aggcggtgacggtggtgctggagtccgcgaaggtacatcgtcatagcttatagtctggggggtttcaacgtcagcgcgcaccattgcaggataccggtta
cgatccttgcgagaatcagctatgcccgatggatacttgtccagtggaaagagagtgtcttcgttgtcacgtagatatagttgctgtctgtcggggtgtt
cttccagccaacgcttgcgcaaggctctccctgcacgggtccggagccaatcctctgccgctttacttcctccaggtacatcttctgctgcctgctcctg
tgcaaacctcgcggcactacgtgaaatatcagcgcctttttcaccagcgtacacccagaaacctctatggcaacgcatcgtgactcgtagcggcttgaac
gcggagacttctaactgttttgaggctaagcaaagctgctaccgcgagacggtatgttattggctgaaatttaccggccagttatttctccccggtccgt
agctgcctcaaactgaccagagaccgggtctc