Description :
From Genome Similarity Track
Location :
Scaffold_70:51293- 58469
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_70-snap-gene-0.37Nipped-B
Pytve_DAOMBR484maker-pve_contig_70-fgenesh-gene-0.21ATP synthase mitochondrial F1 complex assembly factor 2

Sequence
7176 bases(100 bases per row)
TGGCTGTCCAGTCCCGCTGGCGCACCAATGGATGGCGATGCGGTCAATGCACTGCCTGATTGGGCACAAGCAGTGGTGCGCAGCGGCGCATTTGGAGGTA
CAAACATGTTGGCTATTCCACATGCGTAAACTAGTCATCCAGCTGAATTGTGTGCTGACTGGTGCGTTGTCAATTGGCAGAGGTTGGAGGCGACCAACCC
ATGGAAACCATGCTCTCTGACGAAGACGTCGATGGTCAAAGTGATACAGATGCTCGCGGGAGAATGCGAGCTCATCAAAAGAATTCTGAGTCAAAGAAAC
TGGGATCCGATGTCACCGACTCGCAGTATGAATTGGAGGAGAACGACATGGCTGCAGGCACAGAGGAGGTTGACGAGTCTCCTCAGCGCACTTTGTTCAC
GAACGAAGAAGTTGTGGCGGATTCCATCGATAAGTACTCTGAAATGATCGAGAGTTTGGTGGAAAAGCTGTCTGATTCCCAGCAACTGGATGAACCACAA
CGCGACATTCTGGATGTCTTTGAGCACTCGGAGCTGAGACGACTCCTTCAGTCGCTCAAAGTCATGGAGAAGGCAAGCTTCATCCAGAAGATCCAGCCTG
CGTTGCTCATTTCGTTGATGGGGTTTCTGGACAAACAGGTAACGCGCGCTTTGTCTGGCCGTTTGCATACTTTGTGATGATGTACTTACACTTGGTGGTC
CGTATTCAGGTTCAGCATGGGTTAACTTTGGACATCTTGAGCAGTTCAGGACTCGAGCACGGTGCCAACAATGACTGGAAAGCGTCGGGAATGGACATTC
AAGTGATGACCGCATTGGATGCTGGCATTTGCGAATTGATTGTCATGTCTGCCCACGGTGTTGATCGGCGCGTGCTATCTGAAGAGGCGATTGAGAACTG
CGTCCAGCTTCTCAACCACGTCGTGCGGCGACTCATCTTGCCGTGCATCGACACTGGGTTCGCGACGTCCGTGAGTGCTCCGTCAGCCTTGACTCCGAAA
GATGATGAGACGATGGCTGGTGGACATCAACGAGGATCTACCTCTTCTCGAATCAACCTCCGATCGAACAAAAGCCTCCGCAAAGCAGTCGACCGCATCC
TTCCGGTTGTGTGCGAATTCATGGAGTGTTTGGCACAGCTTCTCCAATCAGTCAAGCTGGCGGACAGGTGGATCTTGCAGTTTTCGTCAAGAATGGTAGA
GTTCTTCCTGCTGGAGCACAGTTCGTTTGCCGTGTCTCTGCAGCACAGTGGGTTACTGGTGCTCCGAAGTGTGTTTATGAACTATGAGGCTCATCGCGCC
TTGGTCATGGAGGAAATCGTTGGGGTGATGATGAAGCTCCCGACGGCGAAGCGCAGCTTGCAGACTGTGAAACTCTACAACTCGACAGATTGCATCCAGC
GCGTTTCTACGGTGGTGGTTGCGATGGTGCAGTCGCTCGTTTCGCTTCAACAATTGGACTCTGTTGAGATTGACGTCGGAAACGACCAAGGAGCAGCTGA
TCCAAGTGGCGCTGATGCAGCCGTGATTCCAACCGACTTGAAGACGATAGCAATGTCGACATTGGACGGGACGCGTGATGCTGCTCGACTCTTTGTGCGT
TCACTGCTGAAGGAGTGCTTCAAGAAGACTGACGAACGCGACCATCGTGCGGTGTTGGAAAACTTTGTCGATGACCTGCTTGCGATGGTCGCCCGACCGG
AATGGTCTGGTGCAGAAGTGCTCATGGAGATCCTGAGTTCGTCTCTGGCGAGCATTCTCAGTGGCAACATGTCGAAAGATGCACGCAATCTGGAGTCACA
GCACAGCCTGACTGCTCTCGGTTTGGTTGGCAAGATATGCACCACGATCAAGCTGCATCAGAATTCAGTTGCACGAAACCAGCTTGATGACGATGTTGAT
GCACAAGCTGTGATTGATGATCATAGGAGGTTTCTCGCCGGTGTAGGTGCCCTCAACCGCAAGTATGCCGATGGTGACGCCAGTATGGATGAAGCATCCA
GTCCAGACTTGATATTCAAACATATTGTGATTGCCTGTCTGCGTCGCGGGAATCGGGCCGACATGATACAGGTTGATTCGAGACGGCTGCTGTCGCTGCG
GTTCCTAACCGAGGTTTTTGAGGATACGAATCGGGATCAGCACGAAGCGGACGCAGAAGTCAGCTTGTGGAAATCACTTTGGGGAGTCTCAAGGGGAACC
GGTGATGGTCACTCGAGAGTCCTTCCTCCAACTATGGACTTGGGTATTCGACTGAACTTGCATCTGGTGGTGCTTCGCGACTTTTGTGGGCTGTTTGACA
AGCTGTTGGCTCACATAATGGCGCTACTATCAAACGGAGTCCCAAGTTTCCGTGCTCGAGTGATGAAGGCTCTCGCGGGGATTGTTGATGTCGATCCGCT
ATTGATGGGTGAAGCTGGCGTGCGTGCAGCCGTTCAACGATGCTTTTTGGACGAACGCATCTCTGTCCGTCAGGCTGCGGTTGATTTGGTCGGCAAATAC
GTGATGGTGCAGCCCACTCTGGTACGAAACTTGTATTCCACAAGCAAGATGTGATTGTCTTCGTGCGGACTTACGAGGTGTTGTAGTTTGACAGGTACTT
TGACATGCTGGCTGACCGCCTCCGGGACAAAGGCGTCAGTGTCCGGAAGAGCGTGTGCAAGATTTTCAGGTCCTTTTTGACGCTGCCTCTATTCCAGAAT
CAAGCAAATATTGATGCGACGCCAGAAGAAGATATCCGACGCAGAAGCGCATGCATGAAGAGCTTGGTTGAACGAATTGGCGATGTCACTGAAGATCAAA
TCGTGAAAAGCTTCATCATTGACACATTTCAAGAAGTCTGGTTTGGAGCGGACATGCCATCTCGACGACTTTCATCGCCACTCAACTCTTTTGATGTCCT
TGGTCATGAAAAGCTGCCTCCTGGATGGGTTGCGGTTGACAGCAAGTCAAGCGAAGGCACTCCACATGACAGTCGGAGAAATACACCAACAGGTGCAGAA
TTCCTATCGCCCGACGGGAAAACTGCGCGGTCAATTGAGGAAGCGTGGTCCACGCACCGACGACCAGTTGTGACGCCGTCGAGTGTTGCCAAGACCAAAC
GATCGAAGGTGGATGATTCTGAGGAGGTGACGACGATAATCATCGAAGTAATCCATGATATGCCCAGTCTGGACTGGTTTGTCGCACTCCTGCAGCGATT
GCTTCAAGAAGTCGACCCCACCAAAGACACGGCAGCCAGTGGCGCTCGAGCCTCTAAAGATCGCTCTGCTGAAGTGCAAATCGCTCGTGCACGATCTGAA
AAGCTCGTTTCTTGTCTCGTGGAACGGCTTCTGCAAATCGAGGAAGGAGGCACGCTGACCGGCGTTACCATCTCTGACGCGGAGCAGCAATTCCTTTCTT
GTATGAAGGCTCTTGCAGCATTCTGCGAGGCGTATCCTGACTTACTGATGCCTCATTTGGACCACATGACGCTGTACTTGAAGGGTGACGAGTCCATGAG
CAAAGCCACTGAGCTCAAGGTTCAGACACTTGCGATCTCGATCCTGTCCGACATATTTCGAAGCATGGAGCGCATCACTCCTCGAATCGCTTCGCGTGTG
ACGGAGGATCTTAGCCAGCTGATTGTTCGTTCGCCTCCGAGCGTCGTCGGTCCTAGTGTCAGCTGTCTTTCTATCATCGAAGCTGGAACTAAGAAACCGC
CGCGTGCACTACTGAAGCTCCTTGAACTGTTTTATGGGTTCATGGTCAAGTATTCGGACACCAAGTCGTTTGGGGACCTGTCGTCGGATACGAGTTCAAT
GCTGCAACGCGCATTGTTTACTGCTGGAAAGATTGCTGCCGCTGCGGATGTAGACCAATATCCTTCTCTGGCACATGACACGAAGAAGCTCAGTATCGGC
AATGTCACCGAAGCATTGTACGCTGAATATTCCAAGTACTTGGAAAAGTCTGGAAGTGTAATGTGTGGTGCCACAGCTGTGCAGGGTCTCGGGTTTCTGT
TTCCCCTTCGTCCGCGACTATTCCTGCGAGCACAGCAAGAAGGCATTTTGGTGTCGCTTCTGACGACGTCGCCAGACGAGATGAAGTTGCAGTGTCTGAC
CAGTCTGAACGAGCTTTTGGAGTTCGAAGAACACCGCCTGGAAAAGGGGATTGCATCCAAGAAGATGGATAAAACCAAGTCGAAGCAGGAACAGATTCGC
GGAGATCAAGAAGCCGATGCATCTCTGATTGGCAGCGTTATGCAAGCCCAGCTTACTAATGTGCTGGCTTTGACTCGCAGCCAAATTGCTCGGATTCGCA
CAGAAGCAGTCAAATGCATCGGCAACCTGCTTATCCAGGGCCTTGTGAATCCGCTGCACTGCATTCCCAGCCTGGTTGCGCTGGAGACAGATCGAGTCGC
GTCGATTCGAGATGCTGCTCACTCCCACTTGCTGGAACTCCAACAGAAGTTCCCGAATTTGGTGAATGCGCCGTCGATTCATGGAATTTCACTCTCGTAC
TCGCTCCAAGTGTCGGTGTTCGGAGCAGGCGGTGCTCCAACTGTGTGGGCTCTGGACAAGGACAAGAAGGTTTTTTGTCTGTTCGGTCGGCTATACTCGG
CGTGCATCCGAACGACACGATCACATCGGAATATCTTCCTCCGAGCGCTTGTCAACCAGTTCACTGTGACTGGAAGTGTGTTATCGGTGCTGGACGTGTC
GGAGACACCGACAGCGGCTGTGGCATCCATGCCTACGATTGGATACCTGTGCTACTTGGCCCAGCTCCTCGCTGCGTTGCCTTTCGAGGTGGAAGACGAA
CCGCTGTACATTATTTATTTAATCAACCGCTACATCAGTCTCAAGCTCAGGTAAGGTGCATGCATCCCCTTTGAGCATTTACTGGAGCAGATCTGGCTGA
CCCTATAGGACCTGTGATATATGCTGTGAACAGTACGAGCCTCGACAATTTGAAGCGGGATTTTGAAGCTGGCGGCGTGTTTGAAGGCATTCCCGACGAC
GAAGACCCAGAGCTTGCAGACATTGACATCCGTGGCACGCTGAACTCGTCCGAGCTCACAGATGCTCAATTGCGCGAGCTGCACACGGACGGATGCGTGG
CGTTCGCCCTCTGTCTTCTGATCCGGCTGAAGTTTGCTCTCAAGGATATGTATGGACTTGACGACGAACGGTGCCAAACGTACCGCCCGACCAATGCAGC
AGCCTCCGTACGTGCACATCAGCTGAGTTGTGCGATTGCAGATCATGAACTAACTTTCAACTGCATTGCGATGCTGGGTTATCTACAGGCTGCTGGCGAG
ACTATTACCGTCCCTGAGCGTGCTCGGCGCGCAAAACTTCCAACAGTCGAGCAGTTCAAGGTCGTCGACGCAGTGGAGCTACATTGGATAGTGTTCATGC
AAACGTGGCAGGCGGCTCGCGAAGACCAGCAGCAAATGGACTTCGAAATAGGCGGCGGCAAGACGACCAACATACTGCGCAAGAAGCGACCCCAGCGACG
CAAGTCTTTGCCAGTCAAACGCCAGCGAACGTCCCGCAGAAAGCGCAAGGATGACACGGACGACGATGACAGCGATGACGAGTTGCTGGATGACGATGAG
GAGTTTTGAGGATGAGTTTGCGTGAGGCTGAGGCTGAGGCTGGCATTCGGCTCTCGGCGTCATACTTATCGAAGTCGCCGTCAGCATGCTTGTTTGGATT
CTTGAATTATTTCACAATCGCTCCTTGAGTCCATGCGTAGATTCTGCCGCTCTCCGGCGCTTGACGTCCAGAACGCGCAGCAGCAACGTCTCCATCTCGA
TTGTTGTCATGCGGTACAGTGACGAGAGCGCGAGCGTCGGATCCAATAATGCCAGCCCATCGTCGAACAGCTCGAGCAGCTTGTCAAAGCACCAAAACCG
CTCCGCATCATCTGAGAGCACCTCGCACACTGCGCGGGCAACTGCAATCAGGTACTTCGTGTCGTTCATGCCGCGCATCTGTGCAGGGTCGCGCGCGAGG
ACCAGCCGCCAGAATGAGCGATGAAGCCGAACAAGCGCACGACCCTCTTCTTCCCGTGCGACGCCTCCATTCTGTCCCTCTTCTGTATCTGCTGACACTG
TGTACTCGCGATCTTGCATGTCATCATCGTCGTCTTCAGGTCTCAATTTGATTATCGTTGTTGCCTGCAGCACACTGACGGCAGCTACCAGGTCGCCGTA
CATTTCTTGGCGTTGCTGGCGGACAAACACCCAGGCCGCGGGGATCGCCGGCAGAGCACCCGTGAGCAGTTGCCATGTCAGCGCGCGGTACGCCGGCGCC
ACACCGACCTCGAGCGCGAGCTTGACGAGTTGCAGCACATTGACGCCACCGTTACCACCATTCACAGCTGGGAGATCGTCACTGTCCTTGTCTTTATCGT
TGCCCAGTAGTGCTGCGAACGACGCGTCAACGTCCACGATGTGCTGCACGACTGGGACGCCGAGCGTCTTGTAGTATGTCGTGCGGAAGTTGCGGCTCAG
TGCCATGCCAGTTTTGAGAGTTCCTTTCGAAAAATGACTCTTTTTCACCTCACCAGCGATGATATTGACCAATCACAGGCTCAATCTAAGCCTAAAGGTG
TCGCATTCCGATTCTAAAATGCTCACTTTACAGCTGACGCGAGGTTCTAACAGCGCTCGACGAGACGCGTCTAGTGCTGGTTTTGCAGCAGCCACAGCAG
GAACGAGGCGCTCGAAAGGTTGACGCGGCAGTTGACGCGGTCGAGGTCGTGGCCGCCTTCGACGAGACCCCACCGACCAATCTGGAACTCCTCCTCGACG
CGCGAGATCTCCATTGCCTCGACAGCCGTGATGTGCCGCTTGAAGAGCGCCAGCGCCGTGATCAGCGACTACAACCAGAACGCACACGATAGTCCGTCAG
CTTGACGTCATTATCAGGAGTTGCACGAACCGCCTCACCTTGCACTCCTTCGTCAGGCTTCGGAGTGACGCGAGCTCAAAGTAGCTCAGCTGTCACAAAC
AACCGTTGCGTCAATCGCCAACACCTAGCAACAAGGTTTGAGCCATATGCAAACACGTACTGCCTTGAGGCGGTCGCGCACGTTGCCGACAACACGCTCG
TCGTGCGCCAGCGCGTTGATGGTGCCGTGGCTGACGTCGACGTCGCCGTCGAACTGCTCGGCGAACCACTGGCGCA