Description :
From Genome Similarity Track
Location :
Scaffold_176:5128- 6770
Transcript NameFunction/comments
Phymu_g6099hypothetical protein

Sequence
1642 bases(100 bases per row)
GTAAATTCTTCACTGCAAGAGCCTGTTTCTCCATCCCACAGACTACAAACAGTTCCAGCCACAACCACGAACTTATTGGCGGAATAATGGTAAAACGCAC
GTAAAGGAACCTCGTCAAACTGCTGCACCCGGACGCTGCGCAGATGTTGCAgtgtgcagcttccagacgtGACGATCCACAGGTTTCGACTGTACGGGTG
CGTACAGATAAAAGATAAGGCCTCTACCCGTGCTGATGGCATTCCCAAGTCAATCGATTCCAGTTGAACTGCATGAGACGTACTCGAGACGGACGAACTG
GCGTTGCCCCTGGTAATATCCCACACCTTAAAAATCCCTTGACAATCCCCCGTAATAGCTCGTTCCGTCTGGAAAAGCGCTAATTGCACGCCAATTAGCG
GCGCTCGATGGCCAGATAACGTAAGAGCTACTTGTCGAGAGCTTAAATCCCACGCTAAAGCCTCGAACTCAAAGCCAGCGCTTAGTAGTAAATCGTGCTG
TTGGGAGTAACAAAGCTGTCGAACGCCACGTTCATGAGCCACTAAAGCGCCACGAGCTCGTCCATCGGTAATATCCCACAGCCGGATATTTTGACGGAGG
TCACAGCTCACTAGAAGGTCGTGCGAAGGTATCGCTAGAGCGTCTAAAACCAGATCCGTGTGGCCTGCAAGTCTCCGCCACAGGATTTTCGTCTCCGCAT
CGATTACTTTCCAGATATTCACCATAAAATCGTTCCCAGAGCCTAACAGCAAAGCTGCAGACTCGCAAAAACGAAGGGTTAATTGTGCGGTTGTAGTGGT
TAATCCCAGATTTTTCAACAATCCGAACTCTTTCGATCCGGAATTCCCTGCCACCTTCTTGGAGTCGTTCATGTCGTAAAAGGAAATAGCAAAATCCGTT
GTACTGACGCCGAGCCATTGGAACTTAACGATAAAAACTGCGTCCAGTACCGAAACGCTAGAAGccgatggagctgcagaggTTGTGGGCGTCACGAAAG
CCACGCCGTccccaacaagaagaacgtcgttCATTGGGATCCCCGTAGTGGATTCTCCACCTCCTAAGGTCAATCCATCGGTCTGTGCCTGTTTTTCACT
TGCTACGTTTATTTCAGCCACTAATTTGCCTTCGCTCGTGAAGATTTTCACGGATCGCGCCGGATTTTCCAGTACTAAAAACATCCGAAAGCCTTCCGAC
CATTTCAGCCTCTCGATGCCGGTGCTAACCGGGTTTAAAACGGGGTTGGACGTTGCCGAACCACGTGAATGAACGTTAGGCTCGAGAGTTACAGCGGTCG
TCTTTAGCAAGTGGATAATATCCCGTTCGTAGCGATGTTTCAGTGTCGAGGCTTGTGACCGCGTCGCTACCATTCCAGCGTCTACACAGAAGCTGGTGAA
TTCGTCGAACTCCATGACGCCGTCTCCATTGATGTCAATATCTTCGAACAGGTCGATAAGTGCACTCACACTGGCGGAtttttcctcctccgtccTGGCC
CGTGGTAATCCAGGCAAAACAATCTCCACAAAATCCAGAAGTGGCAAACCGCCTCCCAGTCgcttctcgcgctcgcgGAAGGCATTCgcgatggtggaga
agcctGCGCCCTTCAGACGCATCATGACGTCCATTATGGCCG