Description :
From Genome Similarity Track
Location :
Scaffold_1129:5128- 6386
Sequence
1258 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCGTTCCGCTTCTGGGGCTTGCAGGTGTCTGC
CGCGCAGACGCAGCAGACCACGCGGGAATCGTTCCAGCTGCAGCCCATCCAGGTGTCGACGGCATTGGCGGTTATTATCGGCACCCCTCTTGTCCAGGTT
TTATCACTCAGGTATTGTCCAGGTAGAGTTTTTACGGTTTAAATTACTCTCATTTTCTTCTTTTGATTCCTAGCCACCAGTTAGGGAGACACGTGGCAGC
CCCCCCCCACCCACGAACCGAGGATGGCACGCACGCACAAGACTGCCCAGATCAAGGCGAAGATGGCAGAGCAAGAGCGTGTGGCCGAGGAAGCTCGTCA
GGCTAACCTCGCTCTCTTGCGTGCGGCGCGTACGCGCTCAGAGAGAGCACACGCCAGAGAACTCATGGAGACATCTCGCCCTAGTCCAACTGAAGTAGCA
GAGGACAGCAATGCTCAAGAGCGAGTGGAGGAGGCAACAGAAGACGTCGCAGATGAAGGAGGGGATGGTGAGGAAGGGCAGGGAGGTGTGGACACGTCGA
GTGAAGCAAAGAAGACAACGGGCGATGAAGAGGACGATTCCGTGGAAGATGAAGAGGATGCAGAGGAGGAGAAGGTCGCTTCGGGCGAAGAAGAAGAGGG
TGAAGTGGAAGAAGATGAAGTGGAGACGGAACCAACGAGAAAGCGTCGTCAAGGAAAGAAAAGAACCGTCTCCGATGTCGAAGAAGAAGAGCTGGTTCAG
GTCCCTGTTTTTAAGGCGCATCATGATTCGTGGGCCTCGCTGGAGCAGTCTCTCAAGGAATACATGGAGGCGACGCGCCAAAAAATCGTGGTGAAAGAGG
TGATCAATGTAGCCCGCAGGAATGCTGATCTTCGGCGCCAAGTGAGGTACCAAGGGCTTCCTGACTCAGAGTCGCCTCTCGTCCCTGCAGAGATGGAACC
TTATCAGCGCAAGTTTATCTGTACGCATGGGTGGTCCGAACGTGACAGATCAACGGGAAAGCGGACGTCACACAAGCTGAGTACTACCGATTGTCCGTTT
CAGATGCTGGCTCAAGCTACCAAGCGTAGTGACGGTCAATGGGGCGCTGTGATGAAGCGTGAAGTGTACGCCCATAATCATCGTGTCTCCGAAGACATTT
ACAGGTCTTATCCAGGTATTCGCCAGGTTCCGGCGGACTCACCTTTGATGCCAGGTAT