Description :
From Genome Similarity Track
Location :
Scaffold_86:51272- 53470
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.9Kinesin K39

Sequence
2198 bases(100 bases per row)
CGCGACTTCCCGCCTTGGTCATGGGCCGAAAAAGAGCATGACTGGACCTCGCGCAAGGATGCGGCGTTGCTGTTGGGCATTTACGTTCACGGCTTTGGCG
GGTGGGAAGACATTTTGAACGACGATCTGCTGCACTTTCAGCAGCAGCGTGCGTTGAAGGGTGAGCGCATGAAGAAGCGCGCCGAGAATCTGTTGAAGCG
GTTGCCGTCTCCGGACGAGAGTGGCGAGCCGAAGTTCGTGAATGCTGCGACGGTGCTTGCGTCGGGTCCCCAAAACCCCGGTCAGTCCCTTGGAGCGCAA
TTCAGCGCGATTATTCACAACAATGGCGGCAACAAGGGGAATGGGCCAGTCGTCGTCGCCTCGGCGTCAGCTGCGAGTGGTGGTGGACGGATGCAGCGTG
CCGCTGAGCGTGCAGCCGCTCGACAGCAGGCTGGAGTCGGGAATTCGAGTGTTATCCCAGAGGATTCGATCAGGCGGATGCATCCTCAGCTGAGTAACGG
CAGCCAAACCGGAAGGTATCGCAAATCGTCGGCTGCGAGCTCGCTCAATGGCAACGATGAACCTGAGGATGGCGAGGTGGACAACGAGCGACGAGAGCGA
TCAGGGTCCAACTCGCGCAGCACGAGTCGTGCAAATTCGCCAATCGATAAGTCTTCGTCGAGTGCCGCTCCCCGACGGAGCAGCAGCAGCACGAGCAGCA
AGCGATCGGCCTCGTTAGAGCTGGAGGACTCGGGCAACGAAGTCTCTCTCAAACGGCGAAAGAGCAGTGAAGGCGGATCGAGGAAGCATGGCGTGCAGTC
CACCGCCTCTCGGAGAAGGTTATTGTCAGAAGACGAGTGCTACGACAAGTGGAAACCGAACAAGAAGCTGAAGGACATTCGGCAAGTGCTGAAGAAGATG
AAGATCATGACGCAGTGGTCGAAGAACCAGAAAGATCAGGTGGTGGTGGAGAAGGTGTTCAAGTACATCACGACGATCGGAGATGCGATCGACAAGATTG
TGCGGAAAGCTCGCGTTGACGAAGGCGAGCAGAATGGTGGCCGCGCCAACAGCGACGAGCGCGACGCCGATCGCCCGAGTGATAGCCATGAGTGGGACGA
GCTGTGCTCGTGCCTTTGGACGTATGCTGCCGAGTACACGCCGTTCTCATCGCGGACGTTCGAGCAGCTCTACGACGACATTTGTGCGGATGGCGAGATG
CTGCGCGCGCAACGGCAGCCTACTCCAACGCGGTAATGAAGCTCTACCCTCATCCCCCGAATCGTCGCTGAGCTCGGCATCGCAGCGCTGCATTTGGTTC
AAGACAAAAGTGCTGGCTGCTGGTTCTAGCGCAGTTTCCGCTCGCAGCTCGCGCACATACGTTGCTCTTGTCGCTCAGCACGCACAGCCACGCAGCACAG
AAGTTGCTGCATCTTCGTCATTGTTGCTGCGCAGGATACCTAGCGATTGTCTTCTTCATGAAGGCTCAAATATAATATACCCGTTCTTGTACACCATTTT
GCGAGTGAATAGCGGGAATCGCGACTGTTTGTTGACATGGCATTTGCGGCAGGTCGACGTCAAAGGTCACGGCCGCTTCCATAGCTGGCAAACGACAGGT
CGCTTCGAAACAGCGAGCGAAAATGATGCAAATGATGCCGCCGCCAACTCCTGATGAGCTCGCGCTAAAGGATCAAGTGACCGAGACACTGGCGCAGCAG
GGCGTGCTGGCCAAGATCAAGGTGCGCTCGCCTTGCTGACTGTCTTTGTCATCGTTCGAGTCTGAAACTCGATGGAACCTTCGGTTGTGGACAGGCGGAG
CTTCGAGCGGCCGTGTTCCGCGTCATGCATGACCGCGCGCTGCCGGAGGAGACCAGCTCCGGTCCAAAGCTCGGCGAGTTCCCAGACAAAGTCACGACGA
CCGCTCTCGAATTGATCGTGGACTGCATGTCGTTCTTCCAGTGGGATCATTCGCTGCTCGTCTTACGCGCCGAGGCTGACATCGAGTCGACGCCACTACC
GGTGAAGTGTGCCGAATTGGCCGAGAAGCTGAACCTCAGAGCTCCAGGCGAGAATGCAGCATCAGCGATGCCCTTGCTGCTGCAGTTGGTGGAAGAACGA
CTAAGCAAGCAATCCACGCTCAAATTTGACTCGACAGCAGCTGTGACGTCGCACAAGTTGGAACCACGCGAGGAGATCAGTTCGAGTGCTGACAGATA