Description :
From Genome Similarity Track
Location :
contig_39:512707- 514450
Transcript NameFunction/comments
g8639.t1RAW22258.1 hypothetical protein PC110_g21299 [Phytophthora cactorum
g8640.t1XP_008895061.1 hypothetical protein PPTG_04564 [Phytophthora parasitica INRA-310

Sequence
1743 bases(100 bases per row)
TCCGCGCGTCTTCGATTCTGTTGTCCAGGCGCTTGTCGTACGGTTCGGCACGCGTTTTCTGCCTCCAACCAAGCGCCAATCGCTCCCAGCTTGCCGACTT
TGCCGCGTCAATGAGTTTCCACCACTTGCTGTTGAATTCTTGCTGGACGATGGCCACAGTCCAGACGCCAAGAGTCAACGCTTCGTACTGCAGGCAGCGA
CTACGTTCGCTGTGACCAGCACCGCCACGAATGCACCGCAATGATCGACTTCATTCACCCTTCCGAACTCAGTAGTGACGTTGACGTCGTGGTTCTTGGC
ACAGTCTTCTTCCGAGCGTATTACGCGCACTTCGACTACACCCACAAGCAGGTGGGGCTCGCGTGCACCGTAGACGATAACGGCGTATGTCCTGGTGGTG
TCCAGCCGGCATTAGACTATCGTGGCCGACCGTACGAGTCATTCGAAGACAGGAGACAGTCAAGTCCAAGTTTTGTCGGACTCTGCGCTGCAGCTACCGC
GCTCGCCTTGCTCGCCGGTCTTCAGATGGTGCTGTAGCTCTCCACAAAACCTACACTGTCCCATTGAGCAGCAAAAAACGACACTCAGTTCACAAAGATA
TTCGTTAGTATATGTATTTCTCCACGCGGCAACTCACTTCAAACGTGCACTCGCTCCAGACCACCAGCTAGCCTAGCGAGGTTCCGCTTGCTGTGGCTCC
GGTGGGCGCAACGTTGGCCGTGGGGGCATCCTTCACCCAGATTCGCAAGGTATCCAGCTCGTCTGGAGCTCCTTCTCCACGCATAGCAGGAGTCCCAGGA
CCGAGAGTTCCGTGTTGAGCACCTGCAGACGGCTCCCACTCCGTTTTGAGCTCGATGTCCGGCCGATAGCGCGTCAGAAGCTCGCGCAGTAGCCGCGCGA
ACTCGCTGCGGACAGTCGGGGGGATATGGGCGATCTCCAGCGCCCGTGCACGCAAATCCGTCGTGCGGCCGCACTGCAGCAGGTCAGCGATCCACGTGAG
GCAGAAGCTAAACTTCTTCAGATTGGCCTTGCAGATACCGACGCGCAGCAGATGCAGCAGCTCCGTCTCGCTCGCAAGGCGTGGGCACTTCCGCACGACG
ATAGCCTCGACACGCGCAAACAAGGCGTCCTCGTGCTCCTTGCCGTGCAAGCCTTGGCCATAGCACTTGTCGCACAGCTCGTACTCTTCGCCTGCCAGTA
GACGGCACGTCCGACACACCCACTTGACGCCTGAGAGCGGCCCGCGTCCACAGCCATCGCAAATCGATTCATCCTCGTCGCCAGCAGCATCGGAGCCAGC
CGTCAATGGCACAGGCGATGCATGCGACGAGGAGCTTGTTGTCGAGTTGGACCCCATCGATTGCAGGGACTTGTGCCGACTCAGTCGGTCAAAGACGCTT
CCCACGATCTTCTTGATCTTGCCGTCCTTGCCCTCTTTCTCGCGTGGAGGCATCGGTATGACCTCGCCATCCGAACCCAAAGGGAGCACCCCCATCGACG
ACGGAGACTGCGCTGGAGACGGCAATGCGCCCATAGTCATTGTATGTGTGCGGGTCGTCTCCACTGCGAAGGTCGGGCCTGTGCGCTTGGGGGTCAGCGT
GTAGCGACGCGAGGCCTTGTCCTGCGCCTTGTCCCCGAGTTTATCCAGCGGCGGGATGACTGCCCGCGCCGCAGTGGAGCCGCTGTGAGGGCGAGAGACG
AACATGGCCTTGGTCGCGTGCAGCTCGCGTGGTCCATGGGGCA