Description :
From Genome Similarity Track
Location :
Scaffold_1145:5127- 6751
Transcript NameFunction/comments
Phypl_g12552hypothetical protein

Sequence
1624 bases(100 bases per row)
GGCACCATCACGTTCAAGAGTGTCGACACTGAAGATGTGACTGTCAACATCAAGTCTGGTGGCGATAAGGTTGCCGAGGTACCTGTTCCAGCAGGCAAAA
CCATGACTTGGAAGGCAAATGTGACGGATCTTGCGGGGAAGACGCTGTATCTGGATCGATGGCGTCCGGGTTTCCTGGGTCTCCCTGGAACGGGAGGAGG
CTCCTTGTTGCTGTGGGTCCCTCGATCCACAAAAGGTAGTCTGCACCTTACTGCGATACTCAATGTGAGTTGAGGTTGAGCATGCAGTGGCAATAAAATG
TAAATTATGTAAGAAGCGATTTAAATAAATTATAAGGTATGAACGACGCCGCCGTACGGACATGCTGCCACCATCGTTTTCAAGCTCTTATTAATAACAT
AGCTCGTCGGTGGTATTTTTTTTAGTTTGTTTTTCTCCAATATTTCATTGTCCGATTAGCGAAACTATGAAATTGAGACCCATCACCTTCACCCGAATTC
ATTCTTGAAAGAAGACGACCACTGGAAAAAAAATATTTGAGAACTAAGCTCGCTCAATCGACTCTCATAGGGGGGCAGTCTTGCTACGCAGACTGGTGGC
GaatttgtacatgtactgtacatgtagattCGACCCTACAAAACGTTTGCGCTCTGAGACCACGTTAACTTTTTTGGTGTAGTTTCGAGGCAACCTGCCA
CACCACAGTCGATAAGTCGTTCTGAAGCCAGTTGTAAGTAGTAATACTGCCGGTTACCCTTCTCGTTGGTCGAATGTAGCAGCATACCGCTGCTAATCCT
CGTTCGCCTTCGTAAAGACCACCACGTCACTCGATGTGGTGACTCTCGCGGCGTAGCAGGTTCTCAGATTGAGAATCTCAGCAAGCAAAGTCACAGGCCA
TACGGACGGACCAAAGGACCTGCGCTGCACCTTCACGATATCTTGCGCTGGCCAGATGGAAGTGTGGAATCCCAAACTTGTaagtgtacatgtacatgtg
cACAATCACTCGCTTTGCCTCGGTCAACATCTCTACAAGCGCTTGTGAGCGCTCGTCTTGGTGCTCTACgacgatctgctgctccacggcTTTGTTGAAG
AGATTCGTCGCTACACCGGAATGTAGATTCCCAGTAGCAACAGCACTCGCCCTACTGAAATTGAGGTGGTCGTCGGTGAAACCCGAAGACGCTAATTTTG
CGCATGTGTTGTTAAAAAAATGTAAGTCCTTCATCTTGGTCACTTCATTCCACTTTTTGCTCCATTTGAGAATCGCCACAACTCCGATAAAATGGCCaga
ctacatgtagtcgTAGTTCTGGCCGCTGTTGCCGCAACGATCGGTGAGATCGCTTGGAAAACACACGCATCCAGCAAATGCAAGGTTTCGACATCACCTC
CACTTGTCACGCCAACGGGTGGCAATGACACGACGGTGATCGACTCTGCGGTAACCAGTCAGTCTTCATATTCATCAAGCCTCGACACAAGTTCTGCAGA
CAGCCCGATCCAAACTATACTATCCAGTGTTAATGGTGATTCTctcgacggcgtcgatggCGAGTCTACAGACAGTAGCGGCAACCCATCGCAAACAGAA
GGCGGATCTGCCTCAAGCATGGGA